GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM6041053

Query DataSets for GSM6041053

Status

Public on Apr 15, 2022

Title

or74pu64 Arco (ID 2969)

Sample type

SRA

Source name

Brain

Organism

Lonchura striata

Characteristics

tissue: Brain
region: Arco
ID: 2969
nest: N46
Sex: male
bird.age: 304
reference: posterior
procedure2: intact
duration.of.experiment: 9
library: pool1_bc6

Extracted molecule

total RNA

Extraction protocol

A fast Nissl staining procedure was developed to quickly stain cryosections before laser capture microdissection. Anhydrous 100% ethanol solution was prepared by adding 15 g of molecular sieve beads (Sigma 208582, 3 Å, 8-12 mesh) to 500 mL 100% molecular grade ethanol (Sigma E7023). Cresyl violet staining solution was prepared as by dissolving cresyl violet powder (Sigma) to 4% wt/vol in 75% ethanol (75% molecular grade ethanol, 25% nuclease-free water), stirring for two days, then filtering through a 0.22 μm filter. Before staining, a series of 95%, 75%, 50% ethanol solutions were prepared. To stain, each slide was thawed at room temperature on a bench for 20 seconds then transferred to 95% ethanol for 30 seconds, 75% ethanol for 30 seconds, and 50% ethanol for 30 seconds. 400 μL of cresyl violet staining solution was then applied to the slide for 30 seconds. Slides were destained and dehydrated by transferring to 50% ethanol for 30 seconds, 75% ethanol for 30 seconds, 95% ethanol for 30 seconds, then two rounds of 100% ethanol for 30 seconds each. Slides were then allowed to air dry. Time series experiments indicated that RNA quality was maintained for up to 45 minutes following staining. After staining, slides were loaded onto a Leica LMD7000. Song nuclei were identified by anatomical landmarks (such as lamina and position relative to brain surfaces) and their higher intensity Nissl staining relative to surrounding regions. Sections cut from the surrounding tissue (power 45, aperture 50, speed 10, specimen balance 0, head 90%, pulse 92, offset 15) into 8-well strip caps containing 31.5 μL of RNA Lysis Buffer/PK (see SPRI RNA purification). After filling each cap with a section, the strip was placed onto a 96-well plate pre-chilled on ice and covered with an ice pack. Once a plate was filled, it was vortexed, spun down at 3,250 x g for 5 minutes at 4 °C, then transferred to dry ice. For long-term storage, plates were stored at -80 °C. The following solutions were prepared before LCM section collection: 50% guanidinium thiocyanate (Sigma) in nuclease-free water, 5X CN buffer (250 mM sodium citrate pH 7.0 (Sigma), 5% NP-40 (Sigma)), and RNA Lysis Buffer (20% guanidine thiocyanate, 1X CN buffer). The following solutions were prepared before RNA purification: RNA Wash Buffer (25 mM sodium citrate pH 7.0, 15% guanidinium thiocyanate, 40% isopropanol) and solid phase reversible immobilization (SPRI) bead solution. SPRI bead solution was prepared by first vortexing Sera-Mag SpeedBeads™ Carboxyl Magnetic Beads, hydrophobic (Fisher) until fully suspended transferring 1 mL beads to a 1.5 mL tube. Beads were washed by placing the tube on a tube magnet, waiting until solution cleared, removing the solution, adding 1 mL of TE Buffer (10 mM UltraPure Tris HCl, pH 8.0 (ThermoFisher), 1 mM EDTA pH 8 (ThermoFisher)), and pipetting to mix. This wash was repeated once more, then the beads were resuspended in 1 mL TE Buffer. Separately, 9 g polyethylene glycol 8000 (Amresco), 10 mL 5 M NaCl, 500 μL 1 M UltraPure Tris HCl pH 8.0 (ThermoFisher), 100 μL 0.5 M EDTA pH 8.0 (ThermoFisher), and 500 μL 2% sodium azide (Sigma) were combined and brought to ~49 mL using nuclease-free water. Solution was mixed by inversion until PEG 8000 went into solution. Then, 137.5 μL of 20% Tween-20 and 1 mL of beads/TE were added and mixed by inversion. This SPRI bead solution was then stored at 4 °C. Just before LCM collection, 31.5 μL of RNA Lysis Buffer/PK (1.5 μL of Proteinase K (Ambion), 30 μL of RNA Lysis Buffer) was prepared for each well. To purify RNA following LCM section collection, samples were first allowed to thaw on ice if stored at -80 °C. SPRI bead solution was allowed to come to room temperature, then 40 uL SPRI bead solution was mixed with 47.5 uL isopropanol for each sample. Samples were then lysed by incubating at 42 °C for 30 minutes in a thermocycler then placed at room temperature. 87.5 uL of SPRI/isopropanol solution was added to each sample then mixed 10x by pipetting. Samples were incubated for 5 minutes at room temperature then transferred to a magnetic plate stand. After 3 minutes, the solution was removed, the plate was removed from the magnetic stand, 100 uL of RNA Wash Buffer was added, and beads were resuspended by pipetting. The plate was immediately transferred back to the magnetic plate stand and held there for 2 minutes until the solution cleared. The solution was removed, and the plate was removed from the stand. 100 uL of 70% ethanol was added, beads were resuspended by pipetting 10 times, the plate was returned to the magnetic stand, the solution was allowed to clear for 2 minutes, the solution was removed. This step was repeated for two total ethanol washes. Following the final wash, the beads were allowed to dry for 10 minutes while the plate remained on the stand. Residual ethanol was removed by pipetting. The elute RNA, the plate was removed from the magnet, 15 uL of nuclease-free water was added to each sample, and beads were resuspended by pipetting 10 times. Samples were incubated at room temperature for 5 minutes, then the plate was transferred to a low-elution volume magnetic stand. After 2 minutes or until the solution cleared, 10-12 μL eluted RNA was transferred to new 96-well plates on ice. Plates were sealed using foil adhesive, frozen on dry ice, then transferred to -80 °C for long-term storage.
The SLCR-seq library preparation was adapted from several low input and single-cell RNA-sequencing library protocols (Islam et al., 2014, 2012; Kivioja et al., 2012; Macosko et al., 2015; Picelli et al., 2014, 2013). Barcoded unique molecular identifier (UMI) reverse transcription (RT) primers were prepared in advance in a 96-well plate (RT/TSO/dNTP mix). Each well contained 10 μM barcoded reverse transcription primer (RT_primer, IDT), 10 μM template-switching oligonucleotide with lock nucleic acids (TSO_LNA, Exiqon), and 10 mM dNTPs. Plates were sealed with foil adhesive and stored at -80 °C. Two RT primers were used in this study: one for the initial 18 bird deafening dataset (RT_primer_v1, 25 base UMI, 6 base barcode), and another for the 10 bird unilateral LMAN dataset (RT_primer_v2, 14 base UMI, 12 base barcode). RT_primer_v1 and RT_primer_v2 sets consisted of 24 and 48 barcodes, respectively (Supplemental Table 1). Barcodes were at least one edit distance away from all other barcodes in the set. For library preparation, total RNA prepared from SPRI RNA purification was thawed on ice, then 4 μL total RNA was placed into a well of a 96-well plate chilled on ice. 1 μL RT/TSO/dNTP mix was added and mixed 10 times by pipetting. Plates were sealed with foil adhesive, incubated at 72 °C for 3 minutes, then snap-cooled in ice for at least 2 minutes. An RT Master Mix was prepared containing 1x Enzscript RT buffer (Enzymatics), 5 mM dithiothreitol, 1 mM betaine, 12 mM MgCl2, 0.25 μL Recombinant Ribonuclease Inhibitor (Takara), and 10 U/μL Enzscript Moloney-Murine Leukemia Virus Reverse Transcriptase (Enzymatics). 5 μL of RT Master Mix was added to each sample and mixed by pipetting 10x times. Plates were sealed with foil adhesive and incubated in a thermocycler: 42 °C for 90 minutes, 70 °C for 15 minutes, 4 °C hold. Reactions were then pooled within a barcode set (e.g. barcodes 1-48 from RT_primer_v2 were combined into one tube). To purify cDNA, 0.6x volume of Ampure XP bead solution was added to each pooled sample and mixed by pipetting 10 times. Samples were incubated for 5 minutes and transferred to a tube magnet. After the beads cleared from the solution, the solution was removed, and the beads were washed in 400 μL freshly prepared 80% ethanol for 30 seconds. This step was repeated for a total of two washes. After the second wash, the ethanol solution was removed, and the beads were allowed to dry for 5-10 minutes. Beads were then resuspended in 22 μL of nuclease-free water and incubated for 2 minutes. 20 μL eluted cDNA was transferred to new 1.5 mL LoBind tubes or 96-well plates and either stored at -20 °C or amplified immediately. During the purification a 40 μL cDNA Amplification Master Mix was prepared containing 10 μL KAPA HiFi 5x Buffer, 1 μL 10 mM dNTPs, 4 μL 10 mM TSO_PCR primer, 0.5 μL 1 U/μL KAPA HiFi Hotstart DNA polymerase, and 24.5 μL nuclease-free water. 10 μL of purified cDNA was added to this master mix, pipetted 10x to mix, then amplified under the following cycling parameters: 95 °C for minutes, then 4 cycles of 98 °C for 30 seconds, 65 °C for 45 seconds, and 72 °C for 3 minutes. Reactions were then placed on ice. During this initial amplification, a second master mix was prepared to determine the target number of amplification cycles by quantitative PCR. This mix contained 3 μL KAPA HiFi 5x Buffer, 0.3 μL 10 mM dNTPs, 1.2 μL 10 mM TSO_PCR primer, 0.15 μL 1 U/μL KAPA HiFi Hotstart DNA polymerase, 0.75 μL 20x EvaGreen (Biotium), and 4.6 μL nuclease-free water. 5 μL of preamplified cDNA was added to this mix and amplified in a real-time PCR machine: 98 °C for 3 minutes, followed by 24 cycles of 98 °C for 20 seconds, 67 °C for 20 seconds, and 72 °C for 3 minutes, followed by 72 °C for 5 minutes. The target number of additional cycles was determined by identifying the Ct at 20% of the max fluorescence then subtracting 5 cycles from this number. This number was generally between 5-7 additional cycles. The remaining 45 μL was placed back into the thermocycler and cycled for 98 °C for 30 seconds, the number of additional cycles at 98 °C for 20 seconds, 67 °C for 20 seconds, and 72 °C for 3 minutes, followed by 72 °C for 5 minutes. To purify the amplified cDNA, 0.6x volume of Ampure XP bead solution was added to each reaction and mixed by pipetting 10 times. Samples were incubated for 5 minutes and transferred to a tube magnet. After the beads cleared from the solution, the solution was removed, and the beads were washed in 200 μL freshly prepared 80% ethanol for 30 seconds. This step was repeated for a total of two washes. After the second wash, the ethanol solution was removed, and the beads were allowed to dry for 5 minutes. Beads were then resuspended in 22 μL of nuclease-free water and incubated for 2 minutes. 20 μL eluted cDNA was transferred to new 1.5 mL LoBind tubes or 96-well plates and stored at -20 °C. Sample concentration was quantified using Qubit dSDNA High Sensitivity kit (ThermoFisher), then sample concentrations were standardized to 100 pg/μL. To prepare tagmented DNA, 4 μL (400 pg) of amplified cDNA was added to 10 μL Tagmentation Buffer (Buffer TD from the Nextera XT DNA Sample Prep Kit, Illumina), 1 μL nuclease-free water, and 5 μL ATM (Nextera XT). Reactions were mixed by pipetting 10 times the incubated at 55 °C for 5 minutes. 5 μL of Buffer NT was then added, then the reactions were incubated for 5 minutes at room temperature. Final libraries were constructed by first preparing a PCR master mix containing 20 μL KAPA HiFi 5x Buffer, 2 μL 10 mM dNTPs, 5 μL 10 mM P5-TSO_Hybrid primer, 5 μL 10 mM PCR2 primer, 1 μL 1 U/μL KAPA HiFi Hotstart DNA polymerase, and 42 μL nuclease-free water. PCR2 contains an i7 index (Supplemental Table 1). The 25 μL tagmentation reaction was then added directly to the mix, and mixed by pipetting 10 times. Samples were amplified using 72 °C for 3 minutes; 95 °C for 3 minutes; followed by 16 cycles of 98 °C for 10 seconds, 55 °C for 30 seconds, and 72 °C for 30 seconds; followed by 72 °C for 5 minutes. Samples were then purified by adding 1.2x volumes of Ampure XP, incubating for 5 minutes, then transferring to a tube magnet. After the beads cleared from the solution, the solution was removed, and the beads were washed in 200 μL freshly prepared 80% ethanol for 30 seconds. This step was repeated for a total of two washes. After the second wash, the ethanol solution was removed, and the beads were allowed to dry for 5 minutes. Beads were then resuspended in 22 μL of Low Elution Buffer (10 mM Tris HCl pH 8.0, 0.1 mM EDTA, 0.05% Tween-20) and incubated for 2 minutes. 20 μL eluted cD`NA was transferred to new 1.5 mL LoBind tubes and stored at -20 °C. Library size distributions were assessed using a Bioanalyzer High Sensitivity DNA Chip (Agilent), and library concentrations were determined using the KAPA Library Quantification Kit (Illumina Complete Kit, Roche). Samples were pooled at equal concentrations then size selected using a BluePippin and 2% BluePippin gels. DNA from 180 to 500 bp was selected then purified using the MinElute kit (Qiagen) with two rounds of 10 μL elution in Low Elution Buffer. Samples were stored at -20 °C.

Library strategy

RNA-Seq

Library source

transcriptomic

Library selection

cDNA

Instrument model

Illumina HiSeq 2500

Data processing

Sequencing reads were first trimmed for adaptor sequences using trim_galore (https://github.com/FelixKrueger/TrimGalore, --quality 20, --paired, --overlap 10, adaptors AAAAAAAAAA and GTACTCTGCGTTGATACCACTGCTTCCGCGGACAGGCGTGTAGATCT). We first generated an initial alignment to the Bengalese finch genome (lonStrDom2, GCF_005870125.1) using STAR v2.7.8a (STARsolo mode, default parameters, --outFilterIntronMotifs RemoveNoncanonical) (Dobin et al., 2013). To better annotate the 3’ UTRs of Bengalese finch gene models, we identified transcript 3’ ends by assembling transcripts using these initial alignments and the RNA-seq assembler Stringtie (Kovaka et al., 2019) (--fr -m 100). These Stringtie models were then intersected with the NCBI Bengalese finch transcriptome (lonStrDom2, GCF_005870125.1). New Stringtie exons were filtered by same-strandedness to the intersected references gene, minimal expression level (at least 10% of expression max for a given gene), and at least within 10 kilobases from the 3’ end of the gene. 3’UTRs of the reference transcriptome were extended out to these new exons. Reads were then re-aligned to this extended transcriptome using the ‘bus’ subcommand from kallisto v0.46.1 (Bray et al., 2016; Melsted et al., 2021) followed by barcode error correction using bustools v0.39.3 ‘correct’, sorting using ‘sort’, and read counting using ‘count’.
Gene filtering: genes were kept if they were expressed in at least 1/8 of the total number of samples (8 brain regions were assayed)
Sample filtering: samples were removed if the number of detected genes in the sample was less than 30% of the total number of genes
Assembly: lonStrDom2, GCF_005870125.1
Supplementary files format and content: dat_filtered.csv - Gene (rows) by samples (columns) matrix of unique molecular identifier counts. Column names correspond to ‘id’ column in ‘metadata.csv’
Supplementary files format and content: metadata.csv – Sample-, animal-level metadata for dat_filtered.csv

Submission date

Apr 12, 2022

Last update date

Apr 15, 2022

Contact name

Michael Brainard

E-mail(s)

msb@phy.ucsf.edu

Organization name

University of California, San Francisco

Street address

675 Nelson Rising Ln