 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Apr 28, 2023 |
| Title |
H3K27me3 ChIP of Del(CBS1-5) stembryos at 96h, rep2 |
| Sample type |
SRA |
| |
|
| Source name |
stembryo
|
| Organism |
Mus musculus |
| Characteristics |
tissue: stembryo
cell type: mES cells
genotype: Del(CBS1-5)
stage (in_hours_after_aggregation): 96
chip antibody: H3K27me3 (39155, Active Motif)
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Collected stembryos were pooled in a 15 ml falcon tube, washed with PBS and resuspended in 1 ml PBS containing 1% formaldehyde for fixation during 10 min at room temperature. The crosslink reaction was stopped by adding a glycine solution to a final concentration of 0.125 M. Fixed stembryos were pelleted and stored at -80°C until further use.
ChIP and ChIP-M experiments were performed according to the protocol described in (Rodriguez-Carballo et al., 2017) and (Darbellay et al., 2019), and adapted for stembryos samples. Samples were resuspended in a sonication buffer (Tris HCl pH=8.0 50 mM; EDTA 10 mM; SDS 0.25% and protease inhibitors) and sonicated in a Covaris E220 device for 14 min (duty cycle 2%, peak incident power 105 W) to obtain an average chromatin fragment size of 300-500 bp. A dilution buffer (HEPES pH=7.3 20 mM; EDTA 1 mM; NP40 0.1%; NaCl 150 mM and protease inhibitors) was added to the sonicated chromatin and incubated with the antibody-bead complex (Pierce Protein A/G Magnetic Beads, Thermo Scientific) overnight at 4°C. Sequential washes were then performed twice with RIPA buffer (Tris HCl pH=8.0 10 mM; EDTA 1 mM; Sodium Deoxycholate 0.1% TritonX-100 1%; NaCl 140 mM and protease inhibitors), RIPA High salt buffer (Tris HCl pH=8.0 10 mM; EDTA 1 mM; Sodium Deoxycholate 0.1% TritonX-100 1%; NaCl 500 mM and protease inhibitors), LiCl buffer (Tris HCl pH=8.0 10 mM; EDTA 1 mM; LiCl 250 mM; Sodium Deoxycholate 0.5%; NP40 0.5% and protease inhibitors) and Tris HCl buffer (pH=8.0 10mM and protease inhibitors). For ChIP experiments (H3K27ac (ab4729, Abcam), H3K27me3 (39155, Active Motif), CDX2 (sc-393572, Santa Cruz) and PolII-Ser2p (04-1571, Millipore)), DNA fragments were incubated in the elution buffer (Tris HCl pH=8.0 10 mM; EDTA 5 mM; NaCl 300 mM and SDS 0.1%) containing proteinase K and purified using the Qiagen MiniElute kit. A phosphatase inhibitor (PhosStop, Roche) was used during PolII-Ser2p ChIP incubation and beads wash. The DNA library was produced using TruSeq adapters and amplified with the Kapa HiFi library kit (Roche) using a number of cycles determined by qPCR. For ChIP-M samples (CTCF (61311, Active Motif), PolII (ab817, Abcam), RAD21 (ab992, Abcam) and NIPBL (A301-779A, Bethyl Laboratories)), DNA fragments bound to the antibody-bead complex were tegmented using the Nextera Tegmentation kit. Beads were resuspended in the tegmentation buffer and incubated at 37° for 2 min with 1 µl of the Tn5 transposase. Fragment were then eluted and purified as described previously, and amplified using Nextera primers. Final DNA libraries were purified and size selected using AMPure XP magnetic beads (Beckman Coulter), and a fragment analysis was performed before sequencing
|
| |
|
| Library strategy |
ChIP-Seq |
| Library source |
genomic |
| Library selection |
ChIP |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Data processing |
All scripts are available on https://github.com/lldelisle/scriptsForRekaikEtAl2022
Fastqs of the 3 replicates of wt_144h_pSer2PolII were concatenated before any processing.
Adapter sequences were trimmed from reads using cutadapt (Martin et al 2011) version 1.16 (-a 'GATCGGAAGAGCACACGTCTGAACTCCAGTCAC' -A 'GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT' for ChIP and -a 'CTGTCTCTTATACACATCTCCGAGCCCACGAGAC' -A 'CTGTCTCTTATACACATCTGACGCTGCCGACGA' for ChIPmentation).
Trimmed reads were mapped on mm10 genome or the mutant genome Ins(2xCBS-d4d8) for the corresponding mutant CTCF ChIPmentation) using bowtie2 version 2.3.4.1 (Langmead et al. 2012).
Only aligments with proper pairs and mapping quality above 30 were kept using samtools 1.8.
Peaks and coverage were obtained with macs2 version 2.1.1.20160309 (--format BAMPE --gsize 1870000000 --call-summits --bdg).
In order to better compare ChIP, ChIP for the same protein with a time-course were normalized together using a custom python script (available in the github repository). Similarly, this normalization was used when mutant and control were performed in parallel (see supplementary table).
For H3K27ac and H3K27me3, in figure 7B and S10A, in order to reduce the impact of variations in gastruloid growth speed, the profile of mutant and corresponding wild-type were corrected using the time-course experiment and the profile around the HoxA cluster as a guide (see github repository for more details).
Assembly: mm10 or Ins(2xCBS-d4d8) for the sample Ins(2xCBS-d4d8)_144h_CTCF
Supplementary files format and content: *.narrowPeak.gz: narrowPeak from macs2
Supplementary files format and content: *.bigwig: macs2 coverage
Supplementary files format and content: *_Normalized.bigwig: macs2 coverage normalized between experiments for time-course or mutant and corresponding controls (see supplementary table)
Supplementary files format and content: *_Normalized_HCN_*h.bedgraph.gz: macs2 normalized coverage on the Hox clusters corrected for variation in gastroloid growth speeds using the profile around HoxA cluster and time-course as a guide
|
| |
|
| Submission date |
Jun 09, 2022 |
| Last update date |
Apr 28, 2023 |
| Contact name |
Lucille Lopez-Delisle |
| E-mail(s) |
lucille.delisle@epfl.ch
|
| Organization name |
EPFL
|
| Street address |
Station 19
|
| City |
Lausanne |
| ZIP/Postal code |
1015 |
| Country |
Switzerland |
| |
|
| Platform ID |
GPL19057 |
| Series (2) |
| GSE205779 |
Sequential and directional insulation by conserved CTCF sites underlies the Hox timer in stembryos [ChIP-seq] |
| GSE205783 |
Sequential and directional insulation by conserved CTCF sites underlies the Hox timer in stembryos |
|
| Relations |
| BioSample |
SAMN28944682 |
| SRA |
SRX15652592 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM6226263_Del_CBS1-5_96h_H3K27me3_rep2.narrowPeak.gz |
467.8 Kb |
(ftp)(http) |
NARROWPEAK |
| GSM6226263_Del_CBS1-5_96h_H3K27me3_rep2_Normalized.bigwig |
209.2 Mb |
(ftp)(http) |
BIGWIG |
| GSM6226263_Del_CBS1-5_96h_H3K27me3_rep2_Normalized_HCN_96h.bedgraph.gz |
1.1 Mb |
(ftp)(http) |
BEDGRAPH |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
