|
| Status |
Public on Apr 28, 2023 |
| Title |
RNA-seq of Del(CBS1) stembryos at 96h, rep2 |
| Sample type |
SRA |
| |
|
| Source name |
stembryo
|
| Organism |
Mus musculus |
| Characteristics |
tissue: stembryo
cell type: mES cells
genotype: Del(CBS1)
stage (in_hours_after_aggregation): 96
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Stembryos for each condition were collected and pooled in a 2 ml Eppendorf tube. After centrifugation and medium removal, pelleted stembryos were stored at -80°C until RNA extraction.
RNeasy Plus Micro kit (Qiagen) with on-column DNase digestion was used for RNA extraction following the manufacturer’s instructions.
RNA-seq library preparation with Poly-A selection was performed with 1 µg of purified RNA using the TruSeq Stranded mRNA kit from Illumina and following the manufacturer’s protocol. Library quality was assessed with Fragment analyzer.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Data processing |
All scripts are available on https://github.com/lldelisle/scriptsForRekaikEtAl2022
Adapter sequences were trimmed from reads using cutadapt (Martin et al 2011) version 1.16 (-a 'GATCGGAAGAGCACACGTCTGAACTCCAGTCAC' -A 'GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT').
Trimmed reads were aligned on mm10 with STAR version 2.7.7a (Dobin et al. 2013) with ENCODE options using a custom gtf based on Ensembl version 102 (https://doi.org/10.5281/zenodo.4596490).
Only uniquely mapped reads (tag NH:i:1) were kept using bamFilter version 2.4.1 (Barnett et al. 2011).
FPKM values were computed using cufflinks version 2.2.1 (Trapnell et al. 2010; Roberts et al. 2011) with default parameters.
Assembly: mm10
Supplementary files format and content: *_FPKM.txt.gz: output of cufflinks with FPKM values per gene
Supplementary files format and content: all_FPKM.txt.gz: all FPKM values combined into a single table, one raw per gene_id and one column per sample
|
| |
|
| Submission date |
Jun 09, 2022 |
| Last update date |
Apr 28, 2023 |
| Contact name |
Lucille Lopez-Delisle |
| E-mail(s) |
lucille.delisle@epfl.ch
|
| Organization name |
EPFL
|
| Street address |
Station 19
|
| City |
Lausanne |
| ZIP/Postal code |
1015 |
| Country |
Switzerland |
| |
|
| Platform ID |
GPL19057 |
| Series (2) |
| GSE205781 |
Sequential and directional insulation by conserved CTCF sites underlies the Hox timer in stembryos [RNA-seq] |
| GSE205783 |
Sequential and directional insulation by conserved CTCF sites underlies the Hox timer in stembryos |
|
| Relations |
| BioSample |
SAMN28944739 |
| SRA |
SRX15651646 |
