|
|
GEO help: Mouse over screen elements for information. |
|
Status |
Public on Aug 20, 2022 |
Title |
sur_batch2_rep373 |
Sample type |
SRA |
|
|
Source name |
retina
|
Organism |
Mus musculus |
Characteristics |
cell type: retinal ganglion cell (RGC) strain: B6.129S4-Ptentm1Hwu/J tissue: retina genotype: Pten knock out cell subtype: surviving RGCs (surRGCs)
|
Treatment protocol |
For AAV intravitreal injection, a pulled and polished microcapillary was inserted into the peripheral retina of around 4-week-old mice just behind the ora serrata. Approximately 2 µl of the vitreous was removed to allow injection of 2 µl AAV into the vitreous chamber. ONC was performed 2 weeks following AAV injection at about 7-8 weeks of age and crushed with a jeweler’s forceps (Dumont #5; Fine Science Tools, Foster City, California) for 5 seconds approximately 0.5 mm behind the eyeball. For retrograde labeling regenerating RGCs, the ON was exposed intraorbitally ~1.5-2 mm distal to the eyeball. A piece of tissue paper was placed in between the ON trunk and surrounding soft tissue to keep it from moving. A 33g needle was used to pock a hole on the dura at the injection site first, ~1 mm distal to ONC site. Then a glass micropipette connected with 50μL microsyringe (80900, Hamilton) that attached to a Micro4 controller was used to delivery ~60nL dextran into the ON through the pre-made hole, at a speed of 100nL/min. The leaking dye at injection site were removed by the tissue paper.
|
Extracted molecule |
total RNA |
Extraction protocol |
The fresh isolated retinas at one day post retrograde labeling were dissociated with AMES solution. FACS purification with BD Influx System cell sorter was gated as: Alexa Fluor 488 positive but Texas Red negative RGCs were collected as surRGCs; Texas Red positive RGCs were collected as regRGCs. Individual cell was directly sorted into individual well of 96 well plate with 4ul pre-filled cell lysis buffer, containing 1 U/µl of Recombinant RNase inhibitor (Clontech), 0.1% Triton X-100 (Thermo), 2.5mM dNTP (Thermo), 2.5 µM oligodT30VN (5'AAGCAGTGGTATCAACGCAGAGTACT30VN-3', IDT). Cells were immediately spun down after sorting and frozen at -80°C. RNA libraries were prepared for sequencing using standard Illumina protocols
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic single cell |
Library selection |
cDNA |
Instrument model |
Illumina HiSeq 4000 |
|
|
Data processing |
Illumina's bcl2fastq 2.17 software used for basecalling. Raw data were trimmed by trim-galore (version 0.6.7) to remove adaptor sequences and aligned with Hisat2 (version 2.2.1) to the mouse reference genome (mm10). Transcripts per million reads (TPMs) per gene was calculated by StringTie (version 2.1.7), and genes with TPM > 0 were defined as detected genes. All the downstream analysis was performed by R, using Seurat (version 4.1.0) with modifications. Assembly: mm10 Supplementary files format and content: Matrix table with gene TPM for every gene and every sample
|
|
|
Submission date |
Jun 22, 2022 |
Last update date |
Aug 20, 2022 |
Contact name |
Xue Feng |
E-mail(s) |
xf2019@stanford.edu
|
Phone |
6504417482
|
Organization name |
Stanford
|
Street address |
1651 Page Mill road
|
City |
Palo Alto |
State/province |
CA |
ZIP/Postal code |
94304 |
Country |
USA |
|
|
Platform ID |
GPL21103 |
Series (2) |
GSE206625 |
Single Cell Transcriptome Analysis of Regenerating RGCs Reveals Potent Glaucoma Neural Repair Genes [Second_batch_sur_RGCs] |
GSE206626 |
Single Cell Transcriptome Analysis of Regenerating RGCs Reveals Potent Glaucoma Neural Repair Genes |
|
Relations |
BioSample |
SAMN29245260 |
SRA |
SRX15824475 |
Supplementary data files not provided |
SRA Run Selector |
Raw data are available in SRA |
Processed data are available on Series record |
|
|
|
|
|