|
Status |
Public on Jun 16, 2011 |
Title |
deg-myc |
Sample type |
SRA |
|
|
Source name |
Medicago truncatula roots inoculated with Glomus intraradices (3wpi)
|
Organism |
Medicago truncatula |
Characteristics |
ecotype: Jemalong A17
|
Growth protocol |
Seeds of Medicago truncatula Jemalong A17 were germinated as described in. (Branscheid et al., 2010). Seedlings were grown in a sand: expanded clay substrate (1:1) under 16h light at 25°C and fertilized, unless otherwise noted, twice a week with half strengths Hoagland solution containing 20 µM phosphate. For inoculation with Glomus intraradices, an inoculum was added to the substrate at 10% (v/v). G. intraradices (strain BB-E, provided by Agrauxine, Dijon, France) was used.
|
Extracted molecule |
total RNA |
Extraction protocol |
Total RNA was isolated using the mirVana miRNA isolation kit (Ambion) in combination with the Plant RNA Isolation Aid (Ambion). Poly(A) RNA was isolated from total RNA using the Oligotex mRNA Kit (Qiagen). The degradome libraries from 1 µg poly(A)- enriched RNA were generated according to (German et al., 2009).
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
size fractionation |
Instrument model |
Illumina Genome Analyzer II |
|
|
Description |
degradome processed file: tag count data
|
Data processing |
Removed adaptores. Sequences without adapters were discarded. 3' adapter sequence: TCGTATGCCGTCTTCTGCTTGT
|
|
|
Submission date |
Dec 21, 2010 |
Last update date |
May 15, 2019 |
Contact name |
Patrick May |
E-mail(s) |
patrick.may@uni.lu
|
Organization name |
University of Luxembourg
|
Department |
Luxembourg Centre for Systems Biomedicine
|
Lab |
Bioinformatics Core
|
Street address |
7, avenue des Hauts-Fourneaux
|
City |
Esch-Belval |
State/province |
Luxembourg |
ZIP/Postal code |
L-4362 |
Country |
Luxembourg |
|
|
Platform ID |
GPL11345 |
Series (2) |
GSE26217 |
Degradome sequencing in Medicago truncatula roots (Glomus intraradices colonized and non-colonized) |
GSE26218 |
Small RNA and degradome sequencing in Medicago truncatula roots (Glomus intraradices colonized and non-colonized) |
|
Relations |
SRA |
SRX036739 |
BioSample |
SAMN00189141 |