 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Mar 22, 2023 |
| Title |
PROseq_exp2_LacZKD_FP_05min_rep2 |
| Sample type |
SRA |
| |
|
| Source name |
S2
|
| Organism |
Drosophila melanogaster |
| Characteristics |
cell line: S2
dsrna: LacZ
treatment drug: Flavopiridol (500 nM)
treatment time: 5 min
|
| Treatment protocol |
15 million S2 cells were seeded in 15 mL of FBS-free media, and dsRNA was added at 10 µg/mL for a 45 min pre-incubation, after which 15 mL media with 20% FBS was added (for a final 10% FBS). After 2 days, the dsRNA treatment procedure was repeated, and cells were grown another 2 days. Cells from 2 identically treated T150 flasks were combined, and a sample was taken for spectrophotometric counting (OD600). 38.75 million cells for each dsRNA treatment were divided between 2 tubes for treatment with either DMSO or 500 nM Flavopiridol at 26˚C for the time indicated. Treatments were abruptly stopped by inserting the tubes into ice. Cells were pelleted (4˚C spin at 1000 x g for 5 min) and resuspended in ice-cold PBS. An estimated 8 x 10e4 mouse embryonic fibroblasts (roughly 1:250 ratio to S2 cells) were added as an exogenous spike-in control for normalization.
|
| Growth protocol |
Drosophila melanogaster S2 cells grown at 26˚C in M3+BPYE with 10% FBS
|
| Extracted molecule |
total RNA |
| Extraction protocol |
S2 cells (with spike-in mouse embryonic fibroblasts) were permeabilized following the PRO-seq protocol in Mahat et al. 2016 (PMID: 27442863), with all steps performed within a cold room (4˚C), with cells kept on ice between handling, and all centrifugation steps at 4˚C. Cells were first spun and resuspended in 5 mL Wash Buffer (10 mM Tris-Cl, pH 7.5; 10 mM KCl; 150 mM sucrose; 5 mM MgCl2; 0.5 mM CaCl2; 0.5 mM DTT; 1x Protease inhibitor cocktail (Roche cOmplete); 20 units Superase-In RNase inhibitor) before being resuspended in Permeabilization Buffer (10 mM Tris-Cl, pH 7.5; 10 mM KCl; 250 mM sucrose; 5 mM MgCl2, 1 mM EGTA; 0.05% Tween-20; 0.1% Nonidet P-40 substitute; 0.5 mM DTT; 1x Protease inhibitor cocktail (Roche); 20 units Superase-In) and left on ice for 5 minutes. Cell permeability was assessed >99% under a microscope in the presence of 0.2% Trypan Blue. Permeabilized cells were then washed twice in 5 mL Wash Buffer before being resuspended in 220 µL Storage Buffer (50 mM Tris-Cl pH 8.3; 40% glycerol; 5 mM MgCl2; 0.1 mM EDTA; 0.5 mM DTT) which was divided between 2 aliquots (~9 million cells each) and flash frozen in liquid nitrogen before storage at -80˚C.
PRO-seq was performed as in Mahat et al. 2016 (PMID: 27442863), but for the time-course experiments, a 3’ adapter containing an in-line library-specific barcode (5’-/5Phos/GNNNNNNGAUCGUCGGACUGUAGAACUCUGAAC-/Inverted dT/-3’) which allows libraries to be pooled following the 3’ adapter ligation to reduce the number of samples being handled for all steps downstream.
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
NextSeq 550 |
| |
|
| Data processing |
Adapter trimming using cutadapt v1.18 (--nextseq-trim 10 --minimum-length 15 -a TGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC).
Alignment to rDNA repeats using bowtie2 (--very-sensitive) to count and remove ribosomal RNA reads.
Alignment using bowtie2 (--very-sensitive) to a custom-made “combined” genome containing both dm6 and mm10 chromosomes, but where mm10 chromosomes have been masked for sites that Drosophila S2 cell PRO-seq (without spike-in) (Duarte et al. 2016, PMID: 27492368) can erroneously align uniquely.
R/Bioconductor package BRGenomics v1.4.0 used to process bam files to count and remove spike-in (mm10) reads and to generate and export bigWig coverage tracks made from only the 3’ most base before the run-on position. Spike-in normalization from BRGenomics uses the replicate-specific “batch normalization” approach, with units in relative reads per million (RRPM) (“method = SRPMC”).
Genome_build: dm6
Supplementary_files_format_and_content: bigWig files of stranded, single-base resolution coverage data based on the second-most 3' base in the original RNA insert (the last base incorporated before the run-on). Scores are read counts, with minus strand scores negated. Normalized files in units RRPM (see processing steps/manuscript).
Library strategy: PRO-seq
|
| |
|
| Submission date |
Aug 16, 2022 |
| Last update date |
Mar 22, 2023 |
| Contact name |
Michael DeBerardine |
| E-mail(s) |
mdd238@cornell.edu
|
| Organization name |
Cornell University
|
| Department |
Molecular Biology and Genetics
|
| Lab |
John Lis
|
| Street address |
426 Campus Rd
|
| City |
Ithaca |
| State/province |
NY |
| ZIP/Postal code |
14853 |
| Country |
USA |
| |
|
| Platform ID |
GPL22106 |
| Series (1) |
| GSE211397 |
The NELF pausing checkpoint mediates the functional divergence of Cdk9 |
|
| Relations |
| BioSample |
SAMN30349710 |
| SRA |
SRX17106087 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM6469469_PROseq_exp2_LacZKD_FP_05min_rep2_normalized_minus.bw |
6.0 Mb |
(ftp)(http) |
BW |
| GSM6469469_PROseq_exp2_LacZKD_FP_05min_rep2_normalized_plus.bw |
5.7 Mb |
(ftp)(http) |
BW |
| GSM6469469_PROseq_exp2_LacZKD_FP_05min_rep2_raw_minus.bw |
5.9 Mb |
(ftp)(http) |
BW |
| GSM6469469_PROseq_exp2_LacZKD_FP_05min_rep2_raw_plus.bw |
5.5 Mb |
(ftp)(http) |
BW |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
