|
| Status |
Public on Jan 03, 2024 |
| Title |
Long-14 R3S10 |
| Sample type |
SRA |
| |
|
| Source name |
Human lymphoblastoid cell line
|
| Organism |
Homo sapiens |
| Characteristics |
Sex: Male
cell line: Human lymphoblastoid cell line
|
| Extracted molecule |
total RNA |
| Extraction protocol |
100 μL LCL suspension containing approximately 6.6 x106 cells was taken through the Maxwell 16 miRNA tissue kit protocol using the Maxwell 16MDX instrument following the manufacturer’s instructions, with miRNA eluted in 60 μL RNase-free water.
RNA libraries for small RNA-seq were prepared using the Illumina TruSeq Small RNA library preparation kit following a modified protocol as described previously (Waller et al 2017 doi:10.3389/fnins.2017.00731). For cluster generation 1000 pM of each barcoded cDNA library were pooled together and loaded onto two lanes of the flow cell at 20 pM and 25 pM concentration per lane.
|
| |
|
| Library strategy |
ncRNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina HiScanSQ |
| |
|
| Description |
Long-14
20 pM concentration per lane
|
| Data processing |
Initial QC completed in Illumina Sequencing Analysis Viewer
Sequence data were converted from the generated image .bcl files to raw, demultiplexed sequencing data in the .fastq text file format using the Illumina developed bcl2fastq pipeline.
In OASIS 2.0, an online small RNA data analysis software package the Illumina TruSeq 3′adapter (TGGAATTCTCGGGTGCCAAGG) sequence was removed from the .fastq file of each sample’s reads and the read size filtered (15-32nt) with low abundance reads (<5 reads) discarded.
All remaining reads were mapped to the Human genome (Oasis 2.0: GRCh38 [hg38]). Differential miRNA expression using DESeq2 between patient samples with long disease duration and short disease duration were assessed.
Ingenuity Pathway Analysis (IPA) (Qiagen) was used to analyse the diseases and biological functions of the differentially expressed miRNA associated with disease duration.
Assembly: GRCh38 [hg38]
Supplementary files format and content: Tab-delimited text files include count values for each Sample
|
| |
|
| Submission date |
Aug 26, 2022 |
| Last update date |
Jan 03, 2024 |
| Contact name |
Rachel Waller |
| E-mail(s) |
r.waller@sheffield.ac.uk
|
| Organization name |
The University of Sheffield
|
| Department |
Neuroscience
|
| Street address |
SITraN, 385A Glossop Road
|
| City |
SHEFFIELD |
| State/province |
South Yorkshire |
| ZIP/Postal code |
S102HQ |
| Country |
United Kingdom |
| |
|
| Platform ID |
GPL15456 |
| Series (2) |
| GSE212133 |
Establishing mRNA and miRNA interactions driving disease heterogeneity in ALS patient survival (miRNA-Seq) |
| GSE212134 |
Establishing mRNA and microRNA interactions driving disease heterogeneity in Amyotrophic lateral sclerosis |
|
| Relations |
| BioSample |
SAMN30524848 |
| SRA |
SRX17234841 |
