NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM6531755 Query DataSets for GSM6531755
Status Public on Mar 21, 2024
Title batch2_polya_seq_Fus_P423L_rep1
Sample type SRA
 
Source name ES-E14
Organism Mus musculus
Characteristics cell line: ES-E14
cell type: Embryonic stem cells
genotype: Fus P423L
treatment: none
Extracted molecule polyA RNA
Extraction protocol RNA was purified by Trizol reagent (Sangon Biotech, Cat. #B610409)
Binding oligo: /Index//iSp18/ACTCTGCGTTGATACCACTGCT/iBiodT/CCG/iSpC3/CGGAAGCAGTGGTATCAACGCAGAGTNNNNNNNNNNNN/Reverse complementary sequence of index//ideoxyU/TTTTTTTT/3InvdT/ was synthesized for the enrichment and ligation of poly(A) mRNA. /Index/ was designed as the 8 base pairs of sample index. /iSp18/ was synthesized as an internal 18-atom hexaethyleneglycol spacer. /iBiodT/ was biotin labeled dT. /iSpC3/ was a C3 Spacer designed to increase oligos’ self-anneal. NNNNNNNNNNNN was 12 N as the UMI (unique molecular identifiers) for each sequencing read. /ideoxyU/ was used for USER enzyme digestion to remove the following oligo dT before sequencing. /3InvdT/ was 3’ inverted dT which blocked the reverse transcription from undigested oligo. Low salt buffer (0.15 M NaCl, 20 mM Tris pH 7.5, and 1 mM EDTA) was prewarmed at 70 °C. Binding oligos were dissolved in Low salt buffer to make a final concentration of 8 μM. 10 μl of binding oligo was added to 20 μl Streptavidin Magnetic Beads (Thermo, Cat. #65001) which were washed with Washing/binding buffer (0.5 M NaCl, 20 mM Tris- pH 7.5, and 1 mM EDTA) twice. Samples were incubated at room temperature for 30 min with occasional agitation by hands. Beads were then washed with Washing/binding buffer twice. 5 μg total RNA, which was extracted by Trizol reagent (Sangon Biotech, Cat. #B610409) following the manufacturer’s instructions, was dissolved in 50 μl of Washing/binding buffer, denatured at 65 °C for 5 min, and quickly chilled on ice for 2 min, before being incubated with 20 μl of beads. Samples were incubated at room temperature for 30 min and then washed with Washing/binding buffer twice. 0.8 μl 10 mM ATP, 4 μl T4 RNA ligase Reaction buffer (NEB, Cat. # B0216S), 8 μl 50% PEG8000, 1 μl T4 RNA ligase 2 (NEB, Cat. # M0239), 2 μl RNase inhibitor (NEB, Cat. # M0314S), and 4.2 μl H2O were added and incubated at room temperature for 2 h. Beads were washed with Washing/binding buffer twice, followed by 1X CutSmart buffer (NEB, Cat. # B7204) once. 49 μl 1X CutSmart buffer and 1 μl USER enzyme (NEB, Cat. # M5507) were mixed with the beads and incubated at 37 °C for 30 min. After being washed with pre-warmed 70 °C Low-salt buffer at room temperature for 2 min, beads were washed with H2O once. RT reaction was conducted by adding 4 μl 5X SuperScript IV RT Reaction Buffer (Thermo, Cat. #18091200), 1 μl 10 mM DTT, 1 μl 10 mM dNTP, 1 μl RNase inhibitor, 1 μl TSO oligo AAGCAGTGGTATCAACGCAGAGTACATrGrGrG. 3 μl 50% PEG8000, 1 μl SuperScript IV Reverse Transcriptase (Thermo, Cat. #18091200), and 8 μl H2O and incubating at 50 °C for 30 min. Beads were then washed with Low salt buffer and subsequent H2O once. Pre-PCR was conducted by using 25 μl NEBNext® High-Fidelity 2X PCR Master Mix (NEB, Cat. #M0541S), 1 μl 20 μM PCR oligo AAGCAGTGGTATCAACGCAGAGT, and 24 μl H2O at 98 °C for 3 min; 10 cycles of 98 °C for 10 s, 60 °C for 15 s, and 72 °C for 3 min; 72 °C for 5 min. Samples were purified by 0.9X of VAHTS DNA clean beads to 20 μl. The purified sample was used to construct the sequencing library for Sequel II Systems (PacBio) using SMRTbell Express Template Prep Kit 2.0 kit (PacBio) under the manufacturer’s instructions.
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection cDNA
Instrument model Sequel II
 
Data processing CCS reads were generated from subreads by ccs (version 6.2.0) (https://github.com/nlhepler/pbccs) with the parameters ‘--skip-polish --min-passes 1 --min-rq 0.9’.
To clean CCS reads, we matched barcode sequence (and TSO sequence) in CCS reads and the reverse complementary of CCS reads. The 5′ adapters were trimmed and CCS reads were oriented from 5′ to 3′. Then 3′ adapters were also matched and trimmed.
3′ adapters were also matched and trimmed. Multiple samples in one library will be extracted separately using demux tool of Demultiple (version 1.2.1) (https://github.com/jfjlaros/demultiplex)with parameters ‘-m 1 -d’.
Duplicate CCS reads were removed according to 12 random nucleotides at 3′ of CCS reads.
Assembly: mm9
Supplementary files format and content: Matrix table with raw gene counts for each gene
 
Submission date Aug 31, 2022
Last update date Mar 21, 2024
Contact name Dong Fang
E-mail(s) dfang@zju.edu.cn
Organization name Zhejiang University
Department Life Sciences Institute
Lab Fang lab
Street address 866 Yuhangtang Road
City Hangzhou
State/province Zhejiang
ZIP/Postal code 310058
Country China
 
Platform ID GPL29177
Series (2)
GSE212424 FUS reads histone H3K36me3 to regulate alternative polyadenylation [PolyA-seq]
GSE212425 FUS reads histone H3K36me3 to regulate alternative polyadenylation
Relations
BioSample SAMN30616366
SRA SRX17382761

Supplementary file Size Download File type/resource
GSM6531755_batch2_polya_seq_Fus_P423L_rep1.count.tsv.gz 3.1 Kb (ftp)(http) TSV
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap