|
| Status |
Public on Sep 27, 2022 |
| Title |
601_Mv3_MPE_(20220819_TB_601_Mv3_MPE_20220801) |
| Sample type |
SRA |
| |
|
| Source name |
MPE-seq
|
| Organism |
synthetic construct |
| Characteristics |
source: DNA from MPE-digested chromatin
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
MPE-extraction_TB2021.pdf
Library_Preparation_TB2021.pdf
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
NextSeq 2000 |
| |
|
| Description |
MPE-seq of T19 on 601x7_12bp-linker_pUC19 1:1 histone:DNA ratio
Widom 601 7-copy array with 12-bp linkers in pUC19 cleaved with BamHI and KpnI
|
| Data processing |
Genome_build: pUC19-601x7_KpnI.fasta
1. We used cutadapt 2.9 with parameters "--nextseq-trim 20 -m 20 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT -Z" to trim adapters off 50bp paired-end reads. 2. We used Bowtie2 2.4.2 with options "--very-sensitive-local --soft-clipped-unmapped-tlen --dovetail --no-mixed --no-discordant -q --phred33 -I 10 -X 1000" to map the trimmed reads to the reference sequence: Marseillevirus marseillevirus G648 (Genome_G648.fasta) or Widom 601 7-copy array with 12-bp linkers in pUC19 cleaved with BamHI and KpnI (pUC19-601x7_KpnI.fasta). 3. We extracted properly paired reads from the alignments with bedtools bamtobed to generate a bed file of aligned fragments (Supplementary file fragments.bed.gz). 4. We used bedtools genomecov to make a normalized count bigwig file. Normalized counts are the fraction of counts at each base pair scaled by the size of the reference sequence so that if the scaled counts were uniformly distributed there would be 1 at each position (Supplementary file normalized_counts.bigwig).
|
| |
|
| Submission date |
Sep 02, 2022 |
| Last update date |
Sep 29, 2022 |
| Contact name |
Jorja Henikoff |
| E-mail(s) |
jorja@fhcrc.org
|
| Phone |
206-667-4850
|
| Organization name |
Fred Hutchinson Cancer Research Center
|
| Department |
Basic Sciences
|
| Lab |
Henikoff
|
| Street address |
1100 Fairview AV N, A1-162
|
| City |
Seattle |
| State/province |
WA |
| ZIP/Postal code |
98109-1024 |
| Country |
USA |
| |
|
| Platform ID |
GPL32628 |
| Series (1) |
| GSE193224 |
A giant virus genome is densely packaged by stable nucleosomes |
|
| Relations |
| BioSample |
SAMN30648556 |
| SRA |
SRX17408739 |
