|
| Status |
Public on Sep 19, 2022 |
| Title |
Deug_Aub-IP_oxidised_sRNA |
| Sample type |
SRA |
| |
|
| Source name |
ovaries
|
| Organism |
Drosophila eugracilis |
| Characteristics |
tissue: ovaries
Sex: female
strain: SHL12
genotype: wild type
age: 2 - 7 days old
treatment: oxidised
condition: standard food
|
| Growth protocol |
Flies were kept at standard conditions at room temperature.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Either ovaries or embryos were collected for the RNA extraction. Ovaries were dissected from 3 -7 days old female flies. Embryos were collected between zero to two hours after fertilisation. Embryos were further dechorionated by 20% bleach and further rinsed by water. Total RNA was extracted from ovaries/embryos using TRIZOL.
For oxidised small RNA libraries: Small RNAs were first size-selected by 12% w/v UREA-PAGE, and oxidised using sodium periodate. For non-oxidised small RNA libraries: 2S rRNA was first removed from the total RNA using a biotinylated DNA ligo 'TACAACCCTCAACCATATGTAGTCCAAGCA'. 2S-rRNA-depleted total RNA was then size-selected by 12% w/v UREA-PAGE to yield the pool of small RNA. The oxidised or unoxidised small RNAs were further size-selected by PAGE before 3' and 5' adapters were ligated. The first strand cDNA synthesis was performed using SuperScript II (Thermo Fisher) and the library was amplified using KAPA LongRange DNA polymerase (Sigma) with TruSeq compatible primers.
|
| |
|
| Library strategy |
ncRNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Description |
Aubergine-bound small RNAs (18-40nt) from Drosophila eugracilis embryos, oxidised
|
| Data processing |
genome_build:ASM1815383v1/GCF_018153835.1
Reads in the fastq files were adapter 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC' clipped using fastx_clipper (fastx_toolkit, Hannon Lab) using the default setting. The first and the last four bases were trimmed (both adapters contain four random nucleotides at their respective termini) and reads of >17nt and <41nt were kept for the analyses. Trimmed reads were mapped with bowtie v1.2.3 to the respective genomic sequences (allowing up to one mismatch) or transposon reference sequences (allowing up to three mismatches). The sam file was further processed to the bam file, then to the bed file, the bedgraph file, and finally to the bigWig file, using samtools/1.10, bedtools/2.28.0, and kent-ucsc tools.
Supplementary files format and content: *.tile-coverage.txt: counts of piRNA (>22nt & <41nt) reads that uniquely mapped to the genomic 0.5kb tiles (allowing up to one mismatch), normalised to one million genome unique mappers
Supplementary files format and content: *.TE-mapping.txt: counts of piRNA (>22nt & <41nt) reads that mapped to the transposon reference sequences (allowing up to three mismatches, --all --best --strata option in bowtie), normalised to one million all genome mappers
Supplementary files format and content: *.genome-unique-mappers.bed: bed file of piRNA reads (>22nt and <41nt) that are uniquely mapping to the genome
|
| |
|
| Submission date |
Sep 14, 2022 |
| Last update date |
Sep 20, 2022 |
| Contact name |
Rippei Hayashi |
| E-mail(s) |
rippei.hayashi@anu.edu.au
|
| Phone |
+61-261259396
|
| Organization name |
The Australian National University
|
| Department |
John Curtin School of Medical Research
|
| Street address |
131 Garran Road
|
| City |
Acton |
| State/province |
Australian Capital Territory |
| ZIP/Postal code |
2601 |
| Country |
Australia |
| |
|
| Platform ID |
GPL32665 |
| Series (2) |
| GSE213369 |
Mechanistic divergence of piRNA biogenesis in Drosophila [ncRNA-seq] |
| GSE213383 |
Mechanistic divergence of piRNA biogenesis in Drosophila |
|
| Relations |
| BioSample |
SAMN30869536 |
| SRA |
SRX17578110 |
