|
| Status |
Public on Sep 19, 2022 |
| Title |
Dbif_ChIP_input |
| Sample type |
SRA |
| |
|
| Source name |
ovaries
|
| Organism |
Drosophila bifasciata |
| Characteristics |
tissue: ovaries
Sex: female
stain: Jozankei, Hokaidou
genotype: wild type
age: 2 - 7 days old
condition: standard food
chip antibody: none
|
| Growth protocol |
Flies were kept at standard conditions at room temperature.
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Ovaries were dissected from 3 -7 days old female flies. Ovaries were fixed with PBS containing 2% para-formaldehyde for 10 minutes. After quenching and cell lysis, chromatin was sonicated using BioRuptor (ten cycles of 30sec/30sec ON/OFF).
IP and 5% of input DNA were End-repaired (NEB) and ligated to the NEBNext adapter for Illumina (NEB, E7337A). The libraries were amplified by the Kapa LongRange DNA polymerase (Sigma) with TruSeq compatible primers. Post amplification libraries were size selected at 200-500bp in length in a low-melt Agarose gel.
|
| |
|
| Library strategy |
ChIP-Seq |
| Library source |
genomic |
| Library selection |
ChIP |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Description |
chromatin from Drosophila bifasciata ovaries fixed by formaldehyde
|
| Data processing |
genome_build: UCBerk_Dbif_1.0/GCA_009664405.1
R1 reads were trimmed of the adapter 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC' using fastx_clipper (fastx_toolkit, Hannon Lab) with the default setting. The trimmed reads were then mapped against the genome using bowtie 1.2.3, allowing up to three mismatches. The sam file was further processed to the bam file, then to the bed file, the bedgraph file, and finally to the bigWig file, using samtools/1.10, bedtools/2.28.0, and kent-ucsc tools.
Supplementary files format and content: *.genome-unique-mappers.bed: bed file of reads that are uniquely mapping to the genome
|
| |
|
| Submission date |
Sep 14, 2022 |
| Last update date |
Sep 20, 2022 |
| Contact name |
Rippei Hayashi |
| E-mail(s) |
rippei.hayashi@anu.edu.au
|
| Phone |
+61-261259396
|
| Organization name |
The Australian National University
|
| Department |
John Curtin School of Medical Research
|
| Street address |
131 Garran Road
|
| City |
Acton |
| State/province |
Australian Capital Territory |
| ZIP/Postal code |
2601 |
| Country |
Australia |
| |
|
| Platform ID |
GPL32666 |
| Series (2) |
| GSE213379 |
Mechanistic divergence of piRNA biogenesis in Drosophila [ChIP-seq] |
| GSE213383 |
Mechanistic divergence of piRNA biogenesis in Drosophila |
|
| Relations |
| BioSample |
SAMN30869594 |
| SRA |
SRX17584629 |
