|
Status |
Public on Dec 26, 2022 |
Title |
JLat_Ing3_AZD_Brd4_R5_(220525_DJ_Jl_Ing3_AZD_Brd4_R2_0506) |
Sample type |
SRA |
|
|
Source name |
CUT&Tag
|
Organism |
Homo sapiens |
Characteristics |
cut&tag antibody: BRD4 Cell Signaling Technologies cat# 13440 cell type: Jlat 10.6 cell line transduced with an Ing3 CRISPR gRNA and treated with 10 nM AZD5582
|
Extracted molecule |
genomic DNA |
Extraction protocol |
AutoCUTnTag_protocols_io.pdf CUT&Tag uses tagmentation in which the barcoded adapters are integrated on both sides of the insert, so that the DNA that is released is already a barcoded library. PMID:31036827
|
|
|
Library strategy |
OTHER |
Library source |
genomic |
Library selection |
other |
Instrument model |
NextSeq 2000 |
|
|
Description |
Automated CUT&Tag for Brd4 in the J-Lat 10.6 cell line transduced with an Ing3 CRISPR gRNA and treated with 10 nM AZD5582
|
Data processing |
Genome_build: hg38+HIV_masked.fasta.gz 1. We used cutadapt 2.9 with parameters "-j 8 --nextseq-trim 20 -m 20 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT -Z" on PE50 NextSeq reads. 2. We used Bowtie2 2.4.2 with parameters "--very-sensitive-local --soft-clipped-unmapped-tlen --dovetail --no-mixed --no-discordant -q --phred33 -I 10 -X 1000" to align the clipped reads to the hg38+HIV_masked refererence sequence. This is the Homo sapiens hg38 reference sequence with attenuated HIV provirus inserted on the chromsome 10. 3. We used samtools 1.14 "view" to extract properly paired reads from the alignments. 4. We used bedtools 2.30.0 "genomecov" to make normalized count bigwig files, which are the fraction of counts at each base pair scaled by the size of the reference sequence (3099932747) so that if the scaled counts were uniformly distributed there would be 1 at each position (Supplementary file normalized_counts.bw).
|
|
|
Submission date |
Sep 19, 2022 |
Last update date |
Dec 27, 2022 |
Contact name |
Jorja Henikoff |
E-mail(s) |
jorja@fhcrc.org
|
Phone |
206-667-4850
|
Organization name |
Fred Hutchinson Cancer Research Center
|
Department |
Basic Sciences
|
Lab |
Henikoff
|
Street address |
1100 Fairview AV N, A1-162
|
City |
Seattle |
State/province |
WA |
ZIP/Postal code |
98109-1024 |
Country |
USA |
|
|
Platform ID |
GPL30173 |
Series (2) |
GSE213639 |
A modular CRISPR screen identifies individual and combination pathways contributing to HIV-1 latency |
GSE215430 |
A modular CRISPR screen identifies individual and combination pathways contributing to HIV-1 latency |
|
Relations |
BioSample |
SAMN30921571 |
SRA |
SRX17626258 |