|
Status |
Public on Oct 14, 2022 |
Title |
AXER+/+, ATF6(N/+) Medaka embryo heart, 5 dpf |
Sample type |
SRA |
|
|
Source name |
heart
|
Organism |
Oryzias latipes |
Characteristics |
tissue: heart cell line: Japanese medaka HdrR cell type: whole heart genotype: AXER+/+, ATF6(N/+)
|
Extracted molecule |
total RNA |
Extraction protocol |
RNA was harvested by the acid quanidinium/phenol/chloroform method using Isogen (Nippon Gene, Tokyo, Japan). 20 ng of total RNA was used for the construction of sequencing libraries. RNA-Seq were conducted according to Lasy-Seq ver. 1.1 protocol (https://sites.google.com/view/lasy-seq/).
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
cDNA |
Instrument model |
HiSeq X Ten |
|
|
Description |
RNA-Seq were conducted according to Lasy-Seq ver. 1.1 protocol (https://sites.google.com/view/lasy-seq/).
|
Data processing |
Read 1 reads were processed with fastp (version 0.21.0) (Chen et al., 2018) using the following parameters: --trim_poly_x -w 20 --adapter_sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA --adapter_sequence_r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT -l 31. The trimmed reads were then mapped to the mouse reference sequences of Mus_musculus.GRCm38.cdna.all.fa, using BWA mem (version 0.7.17-r1188) (Li and Durbin, 2009) with default parameters. Read count for each gene was calculated with salmon using -l IU, which specifies library type (version v0.12.0) (Patro et al., 2017). Supplementary files format and content: Read count data for each Sample
|
|
|
Submission date |
Oct 07, 2022 |
Last update date |
Oct 15, 2022 |
Contact name |
Byungseok Jin |
E-mail(s) |
jin.byungseok.6m@kyoto-u.ac.jp
|
Organization name |
Kyoto University
|
Department |
Biophysics
|
Lab |
Graduate School of Science
|
Street address |
Kitashirakawa-oiwake
|
City |
Kyoto |
State/province |
Sakyo-ku |
ZIP/Postal code |
606-8502 |
Country |
Japan |
|
|
Platform ID |
GPL25587 |
Series (1) |
GSE215040 |
Activation of XBP1 but not ATF6α rescues heart failure induced by persistent ER stress in medaka fish |
|
Relations |
BioSample |
SAMN31208669 |
SRA |
SRX17828196 |