NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM6620310 Query DataSets for GSM6620310
Status Public on Oct 14, 2022
Title AXER+/+, ATF6(N/+) Medaka embryo heart, 5 dpf
Sample type SRA
 
Source name heart
Organism Oryzias latipes
Characteristics tissue: heart
cell line: Japanese medaka HdrR
cell type: whole heart
genotype: AXER+/+, ATF6(N/+)
Extracted molecule total RNA
Extraction protocol RNA was harvested by the acid quanidinium/phenol/chloroform method using Isogen (Nippon Gene, Tokyo, Japan). 20 ng of total RNA was used for the construction of sequencing libraries.
RNA-Seq were conducted according to Lasy-Seq ver. 1.1 protocol (https://sites.google.com/view/lasy-seq/).
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection cDNA
Instrument model HiSeq X Ten
 
Description RNA-Seq were conducted according to Lasy-Seq ver. 1.1 protocol (https://sites.google.com/view/lasy-seq/).
Data processing Read 1 reads were processed with fastp (version 0.21.0) (Chen et al., 2018) using the following parameters: --trim_poly_x -w 20 --adapter_sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA --adapter_sequence_r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT -l 31.
The trimmed reads were then mapped to the mouse reference sequences of Mus_musculus.GRCm38.cdna.all.fa, using BWA mem (version 0.7.17-r1188) (Li and Durbin, 2009) with default parameters.
Read count for each gene was calculated with salmon using -l IU, which specifies library type (version v0.12.0) (Patro et al., 2017).
Supplementary files format and content: Read count data for each Sample
 
Submission date Oct 07, 2022
Last update date Oct 15, 2022
Contact name Byungseok Jin
E-mail(s) jin.byungseok.6m@kyoto-u.ac.jp
Organization name Kyoto University
Department Biophysics
Lab Graduate School of Science
Street address Kitashirakawa-oiwake
City Kyoto
State/province Sakyo-ku
ZIP/Postal code 606-8502
Country Japan
 
Platform ID GPL25587
Series (1)
GSE215040 Activation of XBP1 but not ATF6α rescues heart failure induced by persistent ER stress in medaka fish
Relations
BioSample SAMN31208669
SRA SRX17828196

Supplementary file Size Download File type/resource
GSM6620310_DreUjiNishi-113-118.xlsx 1.5 Mb (ftp)(http) XLSX
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap