|
| Status |
Public on Oct 14, 2022 |
| Title |
AXER-/- Medaka embryo heart, 5 dpf |
| Sample type |
SRA |
| |
|
| Source name |
heart
|
| Organism |
Oryzias latipes |
| Characteristics |
tissue: heart
cell line: Japanese medaka HdrR
cell type: whole heart
genotype: AXER-/-
|
| Extracted molecule |
total RNA |
| Extraction protocol |
RNA was harvested by the acid quanidinium/phenol/chloroform method using Isogen (Nippon Gene, Tokyo, Japan). 20 ng of total RNA was used for the construction of sequencing libraries.
RNA-Seq were conducted according to Lasy-Seq ver. 1.1 protocol (https://sites.google.com/view/lasy-seq/).
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
HiSeq X Ten |
| |
|
| Description |
RNA-Seq were conducted according to Lasy-Seq ver. 1.1 protocol (https://sites.google.com/view/lasy-seq/).
|
| Data processing |
Read 1 reads were processed with fastp (version 0.21.0) (Chen et al., 2018) using the following parameters: --trim_poly_x -w 20 --adapter_sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCA --adapter_sequence_r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT -l 31.
The trimmed reads were then mapped to the mouse reference sequences of Mus_musculus.GRCm38.cdna.all.fa, using BWA mem (version 0.7.17-r1188) (Li and Durbin, 2009) with default parameters.
Read count for each gene was calculated with salmon using -l IU, which specifies library type (version v0.12.0) (Patro et al., 2017).
Supplementary files format and content: Read count data for each Sample
|
| |
|
| Submission date |
Oct 07, 2022 |
| Last update date |
Oct 15, 2022 |
| Contact name |
Byungseok Jin |
| E-mail(s) |
jin.byungseok.6m@kyoto-u.ac.jp
|
| Organization name |
Kyoto University
|
| Department |
Biophysics
|
| Lab |
Graduate School of Science
|
| Street address |
Kitashirakawa-oiwake
|
| City |
Kyoto |
| State/province |
Sakyo-ku |
| ZIP/Postal code |
606-8502 |
| Country |
Japan |
| |
|
| Platform ID |
GPL25587 |
| Series (1) |
| GSE215040 |
Activation of XBP1 but not ATF6α rescues heart failure induced by persistent ER stress in medaka fish |
|
| Relations |
| BioSample |
SAMN31208668 |
| SRA |
SRX17828197 |
