|
| Status |
Public on Jan 19, 2023 |
| Title |
SI-NET-seq primary fibroblast IV.3 (F1) R1 |
| Sample type |
SRA |
| |
|
| Source name |
primary fibroblast
|
| Organism |
Homo sapiens |
| Characteristics |
proband: IV.1 (F1) = heterozygous knockdown for TAPT1
molecule: nascentRNA
|
| Treatment protocol |
No treatments were performed.
|
| Growth protocol |
Patient fibroblast cell lines were cultured in DMEM containing 10% FBS (PAN FBS Supreme), 5% penicillin-streptomycin. Murine NIH 3T3 cells that were used as spike ins were grown in DMEM containing 10% FBS (Bovine Calf Serum, iron-fortified, Sigma), 5% penicillin-streptomycin. Fibroblast cell lines were counted and re-seeded at 3,5 x 106 cells/T175 flask twice a week. NIH 3T3 cells were diluted to 4 x 106 cells/T175 flask every two days.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Nascent RNA was extracted as described by Arnold et al., 2021.
Libraries were constructed as described by Arnold et al., 2021 with the following modification: For reverse transcription of nascent RNAs the SuperScript IV Reverse Transcriptase (ThermoFisher) was used.
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina NovaSeq 6000 |
| |
|
| Description |
11 nt random molecular barcodes
|
| Data processing |
library strategy: SI-NET-seq
Data processing of SI-NET-seq data sets was performed similar as described in Arnold et al., 2021.
Pre-processing: The ten 5’ end nucleotides corresponding to the molecular barcode, are trimmed from the reads, but remain associated with the read using a custom python script.
Mapping: Reads are aligned using the STAR aligner (v2.5.3a) (Dobin et al., 2013) with the following parameters : -clip3pAdapterSeq ATCTCGTATGCCGTCTTCTGCTTG -clip3pAdapterMMp 0.21 -clip3pAfterAdapterNbases 1 -outFilterMultimapNmax 1 -outSJfilterOverhangMin 3 1 1 1- outSJfilterDistToOtherSJmin 0 0 0 0 -alignIntronMin 11 -alignEndsType EndToEnd. The reference genome consisted of a joined reference genome which we assembled from human (GRCh38.p12) and mouse (GRCm38.p6) reference genomes. The alignment was performed with the GENCODE annotation v28.
Filtering: We removed putative contaminations such as reverse transcription mispriming events (barcode sequences correspond exactly to the genomic sequence adjacent to the aligned read), PCR duplicates (reads that align to the same genomic position and contain identical barcode) and splicing intermediates (exact single bp 3’ ends of introns and exons) identified by GENCODE annotation v28.
RNA POL II Occupancy: We extracted the position corresponding to the 5’ end of the sequencing read (after removal of the barcode), which corresponds to the 3’ end of the nascent RNA fragment, using a custom python script. Reads mapping to the mouse genome were seperated from human observations.
Masking: In silico masking of loci from abundant non-nascentRNA species as described in the respective publication.
Assembly: Human (hg38/GRCh38) and the spiked-in mouse (mm10/GRCm38)
Supplementary files format and content: bigWig files: raw Pol II occupancy profiles.
|
| |
|
| Submission date |
Oct 11, 2022 |
| Last update date |
Jan 19, 2023 |
| Contact name |
Dr. Andreas Mayer |
| Organization name |
Max-Plack-Institute for molecular genetics
|
| Street address |
Ihnestraße 63-73
|
| City |
Berlin |
| ZIP/Postal code |
14195 |
| Country |
Germany |
| |
|
| Platform ID |
GPL24676 |
| Series (2) |
| GSE197119 |
A Progeroid Syndrome with Severe Osteogenesis Imperfecta segregates with an Intronic TAPT1 homozygous Variant that Creates a knockout allele [NET-seq] |
| GSE197120 |
A Progeroid Syndrome with Severe Osteogenesis Imperfecta segregates with an Intronic TAPT1 homozygous Variant that Creates a knockout allele |
|
| Relations |
| BioSample |
SAMN31236212 |
| SRA |
SRX17846048 |
