GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM6705874

Query DataSets for GSM6705874

Status

Public on Jan 17, 2024

Title

20118a005

Sample type

SRA

Source name

plasma

Organism

Homo sapiens

Characteristics

tissue: plasma
cell type: extracellular vesicles

Extracted molecule

total RNA

Extraction protocol

RNAs were extracted from freshly purified EVs without any freeze/thaw steps in between. To this end, 350 μl of lysis buffer from the SeraMir Exosome RNA Amplification kit (System Biosciences) was added to the purified EVs, vortexed for 15 sec at maximum speed, incubated for 5 mins at room temperature and 200 μl of 100% ethanol (RNA grade) added. The sample was vortexed for 10 sec at maximum speed and the precipitating solution was transferred to an ExoRNA spin column. Samples were bound and washed twice (each 400 µl of wash buffer) with centrifugation steps of 1 min at > 15.000 g. Flow-throughs were discarded. Columns were dried 2 min at > 15.000 g and placed into a new DNA low-bind tube (Eppendorf). 23 μl of RNase free water was directly applied onto the middle of the column without touching it and incubated for 1 min at room temperature. RNAs were eluted by centrifugation for 2 min at < 400 g, followed by centrifugation for 1 min at > 15.000 g. RNA was aliquoted, frozen in liquid nitrogen and stored at -80°C. RNA quality assessment and quantification were carried out using a Agilent 2100 Bioanalyzer with RNA 6000 pico chips (Agilent Technologies).
The sequencing library was prepared using the SMARTer smRNA-Seq Kit (Takara Bio, Kusatsu, Japan) with 100 pg total RNA as input according to the manufacturer's protocol. In short, adenylation of the 3' ends enabled priming of the reverse transcription reaction using an oligo(dT) primer containing the Read 2 adapter sequence for sequencing. Subsequently, cDNA synthesis was performed, making use of the template-switching technology and adding the Read 1 sequencing adapter. Libraries were then amplified in a PCR with 21 cycles using barcoded primers. Eight differently barcoded forward (i5 index) primers and twelve different reverse (i7 index) primers provided in the kit were used in 66 different combinations to enable multiplexing of all 66 samples on one flowcell. After the PCR, samples were cleaned up using the column-based NucleoSpin Gel and PCR Clean-Up kit (Macherey-Nagel, Düren, Germany). The double two-sided size selection described in the user manual was omitted to also retain larger molecules. The molarity of the libraries was assessed using the High Sensitivity NGS assay of the FragmentAnalyzer (Agilent, Santa Clara, USA) for average fragment size, and fluorometric quantitation to measure library concentration with the dsDNA High Sensitivity assay on a Qubit 3.0 (both Thermo Fisher Scientific, Waltham, MA, USA). The libraries were pooled in an equimolar fashion, denatured according to the manufacturer's instructions and diluted to 270 pM. Sequencing was performed on a NovaSeq 6000 (Illumina, San Diego, CA, USA) as 150 bp paired-end reads with an average sequencing depth of 11 Mio clusters (i.e. read-pairs) per sample.

Library strategy

RNA-Seq

Library source

transcriptomic

Library selection

cDNA

Instrument model

Illumina NovaSeq 6000

Description

20118a005

Data processing

After demultiplexing, samples were trimmed using cutadapt v3.2 as follows: Read 1: Remove everything 3' of A10. Read 2: Remove everything 3' of AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT; on the reverse complementary reads remove everything 3' of A10. For final read pairs: In paired end mode keep only reads with a minimum length of 15 base pairs; remove 3 nucleotides from the 5' ends of the reads.
A merged gene annotation was prepared for use with salmon v1.5.2. To this end, the transcript fasta sequences from the GENCODE human release 38 (https://www.gencodegenes.org/human) and the human specific transcript fasta sequences from RNAcentral v19 release (https://rnacentral.org/) were merged. Together with primary assembly genome fasta file (GENCODE) and its decoys, these were used to generate a salmon index.
To quantify sense transcripts, salmon was run with the -l ISF option, for antisense transcripts with the -l ISR option. Common parameters were --validateMappings --softclip --softclipOverhangs --recoverOrphans --incompatPrior 0.0 --seqBias --gcBias --posBias --numBootstraps 100.
Quantification files were imported using tximport v1.20.0 and collapsed to gene level with the non-coding RNA transcripts of the RNAcentral database considered as 'genes'. Variance stabilizing transformed (VST)counts from an intercept matrix in DESeq2 v1.32.0 were used to correct for batch effects (site of sampling, BMI, sequencing batch, sex and age) in limma 3.48.3, and a Euclidean distance with a z of -3 was used to screen for outliers.
Assembly: GRCh38.p13
Supplementary files format and content: tab-delimited text file of normalized counts per sample, sense (ISF) mapping RNAs, DESeq2 output

Submission date

Nov 03, 2022

Last update date

Jan 17, 2024

Contact name

Andreas Neueder

E-mail(s)

andreas.neueder@uni-ulm.de

Organization name

Ulm University

Street address

Helmholtzstrasse 8/1