|
Status |
Public on Jun 14, 2023 |
Title |
Delay-day5-DS-r7 |
Sample type |
SRA |
|
|
Source name |
regenerative bridge from common peroneal to tibial nerve graft
|
Organism |
Mus musculus |
Characteristics |
tissue: regenerative bridge from common peroneal to tibial nerve graft Sex: F mouseid: 298013 repair timing: delay collection day: 5 cell type: distal stump
|
Treatment protocol |
common peroneal nerve graft performed to tibial nerve, either immediately or after an 8 week delay period; a single cell suspension was isolated from the regenerative bridge and sorted using FACS to isolate macrophages and Schwann cells.
|
Growth protocol |
standard mouse housing in research facility
|
Extracted molecule |
total RNA |
Extraction protocol |
Total RNA was isolated with Trizol, with an extra chloroform extraction to remove residual phenol and addition of glyco-blue as a carrier to promote RNA precipitation. For RNA extracted from distal stump samples, RNA concentration was determined with a Nanodrop and integrity assessed on a Fragment Analyzer. For RNA extracted from distal stump samples, rRNA was depleted from 100ng total RNA input using the RiboZero Magnetic Gold H/M/R Kit (Illumina). Directional RNA-seq libraries were prepared from rRNA-depleted RNA using the NEBNext Directional Ultra II RNA Library Prep Kit for Illumina (New England Biolabs). For RNA extracted from 1000 FACS-sorted macrophage and Schwann cells, cDNA was generated and amplified with the SMART-Seq v4 Ultra Low Input RNA Kit (Takara); RNA-seq libraries were prepared with the NEBNext Ultra II FS DNA Library Prep Kit (New England Biolabs) using 4ng amplified cDNA from macrophage samples and 1.5ng from Schwann cell samples.
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
cDNA |
Instrument model |
Illumina NextSeq 500 |
|
|
Description |
DS_rawCounts.txt
|
Data processing |
Illumina pipeline software was used for base calling. Sequenced reads were trimmed for 3' adaptor sequence and low-quality sequence and filtered to remove reads < 50nt with cutadapt v1.8 (-m 50 -q 20 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTC --match-read-wildcards). Processed reads were mapped to the reference genome/transcriptome with tophat v2.1.1 (--no-novel-juncs --library-type fr-firststrand). Cuffnorm from the cufflinks package (v2.2.1) was used to quantify transcripts (--library-type fr-firststrand). Assembly: Mouse mm10 (UCSC) Supplementary files format and content: tab-delimited text files include raw counts per annotated gene for each sample
|
|
|
Submission date |
Nov 03, 2022 |
Last update date |
Jun 14, 2023 |
Contact name |
Jennifer K Grenier |
Organization name |
Cornell University
|
Department |
Biomedical Sciences
|
Lab |
Biotechnology Building rm 333
|
Street address |
526 Campus Rd
|
City |
Ithaca |
State/province |
NY |
ZIP/Postal code |
14853 |
Country |
USA |
|
|
Platform ID |
GPL19057 |
Series (1) |
GSE217172 |
Delay Modulates the Immune Response to Nerve Repair |
|
Relations |
BioSample |
SAMN31581670 |
SRA |
SRX18154394 |