|
Status |
Public on Sep 28, 2023 |
Title |
RNA_pH5.8_1 |
Sample type |
SRA |
|
|
Source name |
bacterial cell
|
Organism |
Escherichia coli str. K-12 substr. MG1655 |
Characteristics |
cell type: bacterial cell genotype: WT treatment: pH 5.8 rna fraction: mRNA
|
Treatment protocol |
Once OD600 = 0.5 was reached, cells were grown further at pH 7.6, or 5M hydrochloric acid was directly added to growing cultutes to adjust pH values to either pH 5.8, or pH 4.4.
|
Growth protocol |
Cells were inoculated to a starting OD600 of 0.05 from overnight cultures and aerobically grown to exponential phase in 200 ml of unbuffered LB media (pH 7.6) in 1 liter glas flasks. After reaching an OD600 of 0.5, cultures were either grown for 30 further min at pH 7.6 under non-stress conditions, 30 min at pH 5.8, or first 15 min at pH 5.8 and then shifted again for 15 min to pH 4.4
|
Extracted molecule |
total RNA |
Extraction protocol |
RNA was harvested using the miRNeasy Mini Kit (QIAGEN) in combination with the RNase-Free DNase Set (QIAGEN) following manufacturer's protocols. Ribosomal RNA depletion was performed using the NEBNext rRNA Depletion Kit for bacteria (NEB) following manufacturer's protocols. Integrity of RNA samples was evaluated by using the RNA 6000 Nano Kit (Agilent). cDNA libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB) following manufacturer's protocols. cDNA library quality was assessed by using a High Sensitivity DNA Kit (Agilent).
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
cDNA |
Instrument model |
NextSeq 1000 |
|
|
Data processing |
Basecalling Adapter sequence "AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC" was trimmed using cutadapt 2.1 (HRIBO 1.6.0) Mapping with segemehl 0.3.4 (HRIBO 1.6.0) rRNA filtering with samtools 1.9 (HRIBO 1.6.0) Coverage file creation with HRIBO 1.6.0 wig files were generated with full read or single nucleotide mapping wig files were normalized using the Counts Per Million (CPM) method and converted to bigwig format Assembly: ASM584v2 Supplementary files format and content: bigwig format files containing CPM normalized read coverage for each sample (global mapping)
|
|
|
Submission date |
Nov 29, 2022 |
Last update date |
Sep 28, 2023 |
Contact name |
Rick Gelhausen |
E-mail(s) |
gelhausr@informatik.uni-freiburg.de
|
Organization name |
Albert-Ludwigs-University Freiburg
|
Department |
Department of Computer Science
|
Lab |
Bioinformatics Group (AG Backofen)
|
Street address |
Georges-Köhler-Allee 106
|
City |
Freiburg |
State/province |
Baden Württemberg |
ZIP/Postal code |
79110 |
Country |
Germany |
|
|
Platform ID |
GPL32899 |
Series (1) |
GSE219022 |
Ribosome profiling reveals the fine-tuned response of Escherichia coli to acid stress |
|
Relations |
BioSample |
SAMN31929673 |
SRA |
SRX18416159 |