 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Apr 21, 2024 |
| Title |
subcutaneous_prenatalT_sheep48 |
| Sample type |
SRA |
| |
|
| Source name |
subcutaneous
|
| Organism |
Ovis aries |
| Characteristics |
tissue: subcutaneous
treatment: prenatalT
cohort: prenatalT
sheepid: 48
|
| Treatment protocol |
Between gestational days 30-90, 100mg T propionate (~1.2mg/kg; Millipore Sigma, St. Louis, MO) suspended in corn oil was administered intramuscularly twice a week to the prenatal T-treated group. In the BPA cohort, between days 30 and 90 of gestation, control animals received vehicle (corn oil) and the BPA-treated group received 0.5mg/kg/day BPA (purity ≥ 99%, catalog number 239658; Aldrich Chemical Co, Milwaukee, Wisconsin) solubilized in corn oil. Both injections of vehicle and BPA were administered daily, subcutaneously.
|
| Growth protocol |
Animals from both cohorts (control and prenatal Testosterone-treated; control and prenatal BPA-treated) were co-inhabited under similar conditions, fed a similar maintenance diet to prevent obesity, and potential phytoestrogen exposure via diet was similar across treatment groups.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Adipose tissue was homogenized with liquid nitrogen and dissolved in Trizol reagent (Life Technologies, Carlsbad, CA) and total RNA isolated as per manufacturer’s recommendations. Residual DNA was removed using the RNeasy binding column, treating with RNAse free DNAse (Qiagen, Germantown, MD) then eluting RNA in nuclease free water.
Libraries for ncRNA were prepared from total RNA using NEBNext smallRNA kit (New England BioLabs, Ipswich, MA) at the University of Michigan Advanced Genomics Core as per manufacturers recommendations
|
| |
|
| Library strategy |
ncRNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Description |
390-MP-21
|
| Data processing |
raw fastq files from ncRNA sequencing were 5’ trimmed using cutadapt (v3.2) as per manufacturers recommendation using the adapter sequence ‘AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC’
Using the built-in function for cutadapt, reads that were of low quality and <17bps were removed from the sequencing data
aligned to sheep reference genome (Oar_rambouillet_v1.0) using STAR (2.6.0c)
counting of reads for each class of ncRNA evaluated in this study was achieved by first subsetting the whole genome annotation files for the reference genome into files that contained only references for a particular ncRNA
aligned reads were then used in featureCounts (1.6.1) with genes as the identifier, with all multimapping reads included in the analysis, along with annotation files specific for each ncRNA to obtain counts
Assembly: Oar_rambouillet_v1.0
Supplementary files format and content: normalized counts of long non-coding RNA for prenatal T cohort
Supplementary files format and content: normalized counts of mircoRNA for prenatal T cohort
Supplementary files format and content: normalized counts of small nucleolar RNA for prenatal T cohort
Supplementary files format and content: normalized counts of small nuclear RNA for prenatal T cohort
Supplementary files format and content: normalized counts of long non-coding RNA for BPA cohort
Supplementary files format and content: normalized counts of mircoRNA for BPA cohort
Supplementary files format and content: normalized counts of small nucleolar RNA for BPA cohort
Supplementary files format and content: normalized counts of small nuclear RNA for BPA cohort
|
| |
|
| Submission date |
Nov 30, 2022 |
| Last update date |
Apr 21, 2024 |
| Contact name |
Kelly Bakulski |
| E-mail(s) |
bakulski@umich.edu
|
| Organization name |
University of Michigan
|
| Department |
Department of Epidemiology
|
| Street address |
1415 Washington Heights
|
| City |
Ann Arbor |
| State/province |
MI |
| ZIP/Postal code |
48109 |
| Country |
USA |
| |
|
| Platform ID |
GPL22509 |
| Series (1) |
| GSE219111 |
Developmental Programming: adipose depot-specific regulation of non-coding RNAs and their relation to coding RNA expression in prenatal testosterone and prenatal bisphenol-A -treated female sheep |
|
| Relations |
| BioSample |
SAMN31950973 |
| SRA |
SRX18439227 |
| Supplementary data files not provided |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data are available on Series record |
|
|
|
|
 |
