|
| Status |
Public on Dec 14, 2022 |
| Title |
CS Hot2 met |
| Sample type |
SRA |
| |
|
| Source name |
Second leaf
|
| Organism |
Triticum aestivum |
| Characteristics |
tissue: Second leaf
genotype: Chinese Spring
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
DNA was extracted from 100 mg lyophilized leaf segments disrupted with two 5 mm glass beads in sealed 96-well 2ml plates. Lysis was performed in 1 ml of lysis buffer at 65°C for 45 min. Subsequently, plates were centrifuged at 1300 × g for 10 min at 4°C. DNA purification was done at a Biomek® NXP automated workstation. A 100 µl of lysate was transferred to a new PCR plate and mixed with 70 µl of isopropanol and 5 µl of Agencourt® Genfind® v2 magnetic beads and incubated for 5 min at RT. Subsequent steps comprised 5 min incubation at the magnet, supernatant discarding, and three-time wash with 100 µl of 70% ethanol. Elution was done in 100 µl of H20 with 10 min incubation at RT and 10 min incubation at the magnet. Eluted DNA was transferred to a new PCR plate.
DNA methylation in the regions with recombination events was determined using the EZ DNA Methylation-Gold Kit (Zymo Research, USA). 400 ng of genomic DNA was bisulfite converted and purified according to the manufacturer's instruction (ver. 1.0.1). For amplification of the bisulfite converted DNA, a set of new primers was designed.
For amplification and sequencing of the Hotspot region part 1 after CT-conversion we used: Hot1_Met_F 5’-TTGTGTGTGTAGTTAGGTATAAAAAGT-3’ and Hot1_Met _R 5’-ACTTCTTCTCCATACATCCTAATC-3’
For amplification and sequencing of the Hotspot region part 2 after CT-conversion we used: Hot2_Met_F 5’- TTGTTTATTTTTTTTATTTAGTGT -3’ and Hot2_Met _R 5’-AAACRAATACCAAAATTTTTCATTCTCTAT-3’
For amplification and sequencing of the Hotspot region part 3 after CT-conversion we used: Hot3_Met_F 5’- TTAAATTTTTAAAGAAGATAAAGAGAG -3’ and Hot3_Met _R 5’- ATATTCCTCCATCACCATCACACTAC -3’
For amplification and sequencing of the Hotspot region part 4 after CT-conversion we used: Hot4_Met_F 5’- TAATAAGATGYGTTGGGTAGAGGTG -3’ and Hot4_Met _R 5’- CTTCTAAACRCCATTAAAAACTTCATTA -3’
For amplification and sequencing of the Rec7 region part 1 after CT-conversion we used: Rec7_1F_Met 5’- GAATGTTATTTGTTAGTAGA -3’ and Rec7_1R_Met 5’- AAACTAAAAACTTTAAAACTTATCAT -3’
For amplification and sequencing of the Rec7 region part 2 after CT-conversion we used: Rec7_2F_Met 5’- TAGTATGAAATATGATATGTTTTT -3’ and Rec7_2R_Met 5’- ATAAATACAACTCAACCAAC -3’
For amplification and sequencing of the Rec7 region part 3 after CT-conversion we used: Rec7_3F_Met 5’- AAAGATAGTAATAGAAGTAATAAGT -3’ and Rec7_3R_Met 5’- TAAAACCTTACAATCCAACA -3’
For amplification and sequencing of the Rec7 region part 4 after CT-conversion we used: Rec7_4F2_Met 5’- TTTGAGTTGTTGTTATAATT -3’ and Rec7_4R4_Met 5’- CTTCACCAACRACTCCAA -3’
For amplification and sequencing of the Rec7 region part 5 after CT-conversion we used: Rec7_5F4_Met 5’- ATTTAATAAAGTTTAGAGTTYG -3’ and Rec7_5R3_Met 5’- ACACCCRCCATACCTTAA -3’
For amplification and sequencing of the Rec7 region part 6 after CT-conversion we used: Rec7_6F_Met 5’- TTTGTTAAAAATTAAGGTATGG -3’ and Rec7_6R_Met 5’- ATATTTTCATACCTAAATCACATAAA -3’
For amplification and sequencing of the Rec7 region part 7 after CT-conversion we used: Rec7_7F_Met 5’- TGAAGAAAATTTTGAAAAATATGAA -3’ and Rec7_7R_Met 5’- ATTCCRACAATTTATTTTTA -3’
|
| |
|
| Library strategy |
Bisulfite-Seq |
| Library source |
genomic |
| Library selection |
RANDOM |
| Instrument model |
AB 5500xl Genetic Analyzer |
| |
|
| Description |
AB 3730xL Genetic Analyzer
H1 part 2
|
| Data processing |
Geneious Prime version 2020.2.4
Bisulfate sequencing reads obtained for forward and reverse primers were aligned and trimmed.
Assembly: Wheat Chinese Spring IWGSC RefSeq v1.0 genome assembly (2018)
Supplementary files format and content: FASTA format text files.
|
| |
|
| Submission date |
Dec 09, 2022 |
| Last update date |
Dec 15, 2022 |
| Contact name |
Maciej Majka |
| E-mail(s) |
majkam@ueb.cas.cz
|
| Organization name |
Institute of Experimental Botany AS CR
|
| Street address |
Šlechtitelů 31
|
| City |
Olomouc |
| State/province |
Please select a region, state or province. |
| ZIP/Postal code |
77900 |
| Country |
Czech Republic |
| |
|
| Platform ID |
GPL32931 |
| Series (1) |
| GSE220598 |
The chromatin determinants and Ph1 gene effect at wheat sites with contrasting recombination frequency |
|
| Relations |
| BioSample |
SAMN32126944 |
| SRA |
SRX18549811 |
