|
Status |
Public on May 04, 2023 |
Title |
Kc167_RNApolIIser5P_ActinomycinD_Rep2_(220317_MW_DmHs_AA78_3722_6) |
Sample type |
SRA |
|
|
Source name |
CUT&Tag
|
Organism |
Drosophila melanogaster |
Characteristics |
antibody: anti-Phospho-Rpb1 CTD (Ser5) (D9N5I) #13523s cell type: Kc167 Drosophila melanogaster cell line originally derived from disaggregated 8-12 hour embryos.
|
Extracted molecule |
genomic DNA |
Extraction protocol |
https://www.protocols.io/view/cut-amp-tag-direct-with-cutac-x54v9mkmzg3e/v3 CUT&Tag uses tagmentation in which the barcoded adapters are integrated on both sides of the insert, so that the DNA that is released is already a barcoded library. PMID:31036827
|
|
|
Library strategy |
OTHER |
Library source |
genomic |
Library selection |
other |
Instrument model |
NextSeq 2000 |
|
|
Description |
CUT&Tag data profiling paused RNA pol II (ser5P) in Drosophila melanogaster cells treated with aclarubicin for 30 minutes
|
Data processing |
Genome_build: dm6 1. We used cutadapt 2.9 with parameters "-j 8 --nextseq-trim 20 -m 20 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT -Z" to trim adapters from 50bp paired-end reads. 2. We used Bowtie2 2.4.2 with options "--very-sensitive-local --soft-clipped-unmapped-tlen --dovetail --no-mixed --no-discordant -q --phred33 -I 10 -X 1000" to map the paired-end 50bp reads to the dm6 Drosophila melanogaster reference sequence obtained from UCSC. 3. We used Bowtie2 2.4.2 with options "--end-to-end --very-sensitive --no-overlap --no-dovetail --no-mixed --no-discordant -q --phred33 -I 10 -X 1000" to map the same paired-end 50bp reads to the masked hg19 Homo sapiens reference sequence obtained from UCSC. 4. We extracted properly paired reads from the D. melanogaster alignments. 5. We counted the properly paired reads from the Homo sapiens alignments. 6. We used bedtools 2.30.0 genomecov to make a normalized count dm6 track which is the fraction of counts at each base pair scaled by the size of the dm6 reference sequence (137567484) so that if the counts were uniformly distributed across the reference sequence there would be one at each position (Supplementary file .norm.bw) 7. We used bedtools 2.30.0 genomecov with a scaling factor of (10000/number of fragments mapped to masked hg19) to create a calibrated dm6 track file (Supplementary file .Hs_spike.bw).
|
|
|
Submission date |
Dec 18, 2022 |
Last update date |
May 04, 2023 |
Contact name |
Jorja Henikoff |
E-mail(s) |
jorja@fhcrc.org
|
Phone |
206-667-4850
|
Organization name |
Fred Hutchinson Cancer Research Center
|
Department |
Basic Sciences
|
Lab |
Henikoff
|
Street address |
1100 Fairview AV N, A1-162
|
City |
Seattle |
State/province |
WA |
ZIP/Postal code |
98109-1024 |
Country |
USA |
|
|
Platform ID |
GPL30203 |
Series (1) |
GSE221252 |
Aclarubicin stimulates RNA polymerase II elongation at closely spaced divergent promoters |
|
Relations |
BioSample |
SAMN32301478 |
SRA |
SRX18761730 |