 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Apr 15, 2024 |
| Title |
MS2_Rep2_HA |
| Sample type |
SRA |
| |
|
| Source name |
HEK293T
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: HEK293T
antibody: HA
overexpression: FLAG-HA-MCP
|
| Treatment protocol |
Oligo pools were transfected into HEK293T cells using X-tremeGENE HP DNA Transfection Reagent (Roche) according to manufacturer’s instruction. Cells were harvested 48 hours post-transfection by scraping, collected by centrifugation at 500 x g for 5 minutes at 4C, and washed once with cold PBS. Cells were cross-linked in cold PBS resuspension (~5 million cells/mL) with 0.1% formaldehyde for 10 minutes on a nutator at room temperature. To cease the reaction, glycine was added to cells with a final concentration of 125 mM followed by incubation for 5 minutes on a nutator at room temperature. Cross-linked cells were centrifuged at 500 x g for 5 minutes at 4C. Cross-linked cell pellets were washed twice with PBS including cOmplete Protease Inhibitor Cocktail (Roche), flash-frozen and stored at -80C until use.
|
| Growth protocol |
HEK293T cells cultured in DMEM plus 10% FBS, 1% Penicillin-streptomycin, and 1% GlutaMAX supplement (Gibco) were passaged onto 15-cm dishes.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
For the reverse cross-linking reaction, lysates were mixed with 33 μL of reverse crosslinking buffer (3X PBS, 6% N-Lauroylsarcosine, 30 mM EDTA, 15 mM DTT), 10 μL of Proteinase K (Ambion), and 1 μL of RNaseOUT (Invitrogen) and incubated at 42C for 1 hour then 55C for 1 hour. TRIzol (Invitrogen) and chloroform, followed by RNeasy Plus Mini Kit (Qiagen), were used to isolate RNAs.
Sequencing libraries were generated using customized primers that anneal to the universal priming sites on the oligos and attach Illumina-compatible sequencing adapters: reverse primer (AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT), forward primer (caagcagaagacggcatacgagatCGTGATgtgactggagttcagacgtgtgctcttccgatctACTGGCCGCTTCACTG, CGTGAT is a Illumina truseq index and can be variable).
Amplicon sequencing was performed with a single-end run.
|
| |
|
| Library strategy |
RIP-Seq |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Description |
MS2_count.txt
|
| Data processing |
The sequencing reads were assigned to the designed oligonucleotides by mapping barcode sequences. Barcode sequences can be retrieved from the provided oligo pool fasta file: it is 10 nucleotides long from the end following the removal of the final 17 nucleotides.
Sequencing reads were counted for a given oligonucleotide if they have less than or equal to 2 mismatches between a read and a designed target sequence. The designed target sequences can be retrieved from the provided oligo pool fasta file: it is the remaining sequence following the removal of the first 16 nucleotides and the final 27 nucleotides.
Assembly: Not applicable, using custom sequences
Supplementary files format and content: Tab-delimited files include sequencing read counts for oligonucleotides and samples.
|
| |
|
| Submission date |
Dec 21, 2022 |
| Last update date |
Apr 15, 2024 |
| Contact name |
Taeyoung Hwang |
| E-mail(s) |
taeyoungh@gmail.com
|
| Organization name |
Lieber Institute for Brain Development
|
| Street address |
855 N. Wolfe St, 3rd floor, Suite 300
|
| City |
Baltimore |
| State/province |
MD |
| ZIP/Postal code |
21205 |
| Country |
USA |
| |
|
| Platform ID |
GPL18573 |
| Series (1) |
| GSE221537 |
Massively Parallel Dissection of RNA in RNA-protein Interactions in vivo |
|
| Relations |
| BioSample |
SAMN32353458 |
| SRA |
SRX18811956 |
| Supplementary data files not provided |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data are available on Series record |
|
|
|
|
 |
