|
| Status |
Public on Jan 25, 2023 |
| Title |
RNA-seq, 37°C [rna_wt_37_1] |
| Sample type |
SRA |
| |
|
| Source name |
whole cell extract
|
| Organism |
Saccharomyces cerevisiae |
| Characteristics |
cell type: whole cell extract
genotype: BY4741 CDC33-HIS3
treatment: 37degreeC for 1 hour
|
| Treatment protocol |
1 hour at 25°C or 37°C
|
| Growth protocol |
Grown in YPD at 25°C to OD ~0.5
|
| Extracted molecule |
polyA RNA |
| Extraction protocol |
Ribosome protected RNAs were isolated by collecting whole cell extracts, treating with Rnase, centrifugation over sucrose gradients 10-50%, isolating mono- and polysomes, and then extracting RNA using a hot phenol method. Total RNA for RNA-seq was extracted using a hot phenol method.
mRNAs were enriched from total RNA using oligodT beads. Ribosome protected fragments and fragmented mRNAs were dephosphorylated using T4 polynucleotide kinase (NEB). Fragments were then ligated to a short adenylated DNA oligonucleotide – 5’rAppCTGTAGGCACCATCAAT/3ddC/3’ – at their 3’ end using truncated T4 RNA ligase 2 (NEB). Ligated products were purified using denaturing urea PAGE and subjected to reverse transcription using M-MLV (Promega) and RS-1 primer (/5Phos/AGATCGGAAGAGCGTCGTGTAGGGAAAGAGT GTAGATCTCGGTGGTCGC/iSp18/CACTCA/iSp18/TTCAGACGTGTGCTCTTCCG ATCTATTGATGGTGCCTACAG). Following PAGE purification, cDNA products were circularized using CircLigase kit (Epicentre). Optimal amplification cycle number was determined via pilot PCR before PCR amplification with unique barcoded primers.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Description |
DESeq2 Differential Expreesion.xlsx
Metagene Analysis.xlsx
Multivariate Analysis.xlsx
|
| Data processing |
Reads were processed using cutadapt 4.1 to remove the linker sequence: CTGTAGGCACCATCAAT with at least 15 nt match. For ribosome profiling reads, only reads with linker were kept while for RNA-seq reads, only reads without linker were kept
rRNAs, tRNAs, and other ncRNAs were removed by first mapping to the SGD R64-1-1 ncRNA file using Hisat2 2.2.1
Reads were mapped to the transcriptome using Salmon 1.9.0 or the genome using STAR 2.7.10b.
Transcriptome mapped reads were analyzed using DESeq2 1.32.0. Genome mapped reads were analyzed using FeatureCounts 2.01 and custom python scripts. Reads were also processed using Samtools 1.16.1 and Bedtools 2.30.0 to determine metagene coverages.
Assembly: SGD R64-1-1
Supplementary files format and content: Excel files of differential expression and metagene statistics.
Supplementary files format and content: Excel file of the multivariate analysis looking at possible correlations between various features and differential expression.
Supplementary files format and content: Excel file of the analysis of differentially expressed genes upregulated by Hsf1 and Msn2/Msn4.
|
| |
|
| Submission date |
Jan 23, 2023 |
| Last update date |
Apr 29, 2024 |
| Contact name |
Hani Zaher |
| E-mail(s) |
hzaher@wustl.edu
|
| Organization name |
Washington University in St. Louis
|
| Department |
Biology
|
| Street address |
1 Brookings Drive
|
| City |
St Louis |
| State/province |
MO |
| ZIP/Postal code |
63130 |
| Country |
USA |
| |
|
| Platform ID |
GPL17342 |
| Series (1) |
| GSE223465 |
eIF4F complex dynamics are important for the activation of the integrated stress response |
|
| Relations |
| BioSample |
SAMN32874438 |
| SRA |
SRX19141036 |
