|
| Status |
Public on Jul 13, 2023 |
| Title |
BY_K27me3_KHRM3_5cpw_(220817_DJ_Hs_BY_K27me3_KHRM3_5cpw_220802) |
| Sample type |
SRA |
| |
|
| Source name |
sciCUT&Tag
|
| Organisms |
Homo sapiens; Mus musculus |
| Characteristics |
scicut&tag antibody: H3K27me3 Cell Signaling Technologies cat# C36B11
human cell lines: H1, K562, RS4;11 and ML-2
mouse cell line: 3T3
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
scCUTnTag_protocol.pdf
scCUTnTag_protocol.pdf
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
NextSeq 2000 |
| |
|
| Description |
sciCUT&Tag for H3K27me3 run on a mixture of Human Cell Lines and mouse 3T3 cells and dispensed on the ICELL8 at a concentration of 5 nuclei per nanowell
|
| Data processing |
Genome_build: hg38
Genome_build: mm10
1. We used cutadapt 2.9 with parameters "-j 8 --nextseq-trim 20 -m 20 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT -Z" to trim adapters from 50bp paired-end reads. 2. We used Bowtie2 2.4.2 with options "--very-sensitive-local --soft-clipped-unmapped-tlen --dovetail --no-mixed --no-discordant -q --phred33 -I 10 -X 1000" to map the paired-end 50bp reads to the repeat-masked hg38 Homo sapiens reference sequence obtained from UCSC. 3. We used samtools 1.14 "view" to extract properly paired reads from the D. melanogaster alignments. 4. We used bedtools 2.30.0 "genomecov" to make a normalized count hg38 track which is the fraction of counts at each base pair scaled by the size of the hg38 reference sequence (3210038034) so that if the counts were uniformly distributed across the reference sequence there would be one at each position (Supplementary file .hg38.bw) 5. We repeated steps 2-4 to map the paired reads to mm10 Mus Musculus. (Supplementary file .mm10.bw)
|
| |
|
| Submission date |
Feb 06, 2023 |
| Last update date |
Jul 13, 2023 |
| Contact name |
Jorja Henikoff |
| E-mail(s) |
jorja@fhcrc.org
|
| Phone |
206-667-4850
|
| Organization name |
Fred Hutchinson Cancer Research Center
|
| Department |
Basic Sciences
|
| Lab |
Henikoff
|
| Street address |
1100 Fairview AV N, A1-162
|
| City |
Seattle |
| State/province |
WA |
| ZIP/Postal code |
98109-1024 |
| Country |
USA |
| |
|
| Platform ID |
GPL30202 |
| Series (1) |
| GSE224579 |
Scalable single-cell profiling of chromatin modifications with sciCUT&Tag |
|
| Relations |
| BioSample |
SAMN33102967 |
| SRA |
SRX19289051 |
