|
Status |
Public on Jul 13, 2023 |
Title |
PBMC_K4me123_B_0.25X_(220826_DJ_Hs_PBMC_K4me123_MM_0.25X_220527) |
Sample type |
SRA |
|
|
Source name |
sciCUT&Tag
|
Organism |
Homo sapiens |
Characteristics |
scicut&tag antibody: A mixture of H3K4me1 Invitrogen cat# 710795, H3K4me2 Millipore cat# 07-030, H3K4me3 Active Motif cat# 39159 human sample: PBMCsw from healthy donor B
|
Extracted molecule |
genomic DNA |
Extraction protocol |
scCUTnTag_protocol.pdf scCUTnTag_protocol.pdf
|
|
|
Library strategy |
OTHER |
Library source |
genomic |
Library selection |
other |
Instrument model |
NextSeq 2000 |
|
|
Description |
sciCUT&Tag for H3K4me123 run on PBMCs from healthy donor B and dispensed on the ICELL8 at a concentration of 6 nuclei per nanowell
|
Data processing |
Genome_build: hg38 1. We used cutadapt 2.9 with parameters "-j 8 --nextseq-trim 20 -m 20 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT -Z" to trim adapters from 50bp paired-end reads. 2. We used Bowtie2 2.4.2 with options "--very-sensitive-local --soft-clipped-unmapped-tlen --dovetail --no-mixed --no-discordant -q --phred33 -I 10 -X 1000" to map the paired-end 50bp reads to the repeat-masked hg38 Homo sapiens reference sequence obtained from UCSC. 3. We used samtools 1.14 "view" to extract properly paired reads from the D. melanogaster alignments. 4. We used bedtools 2.30.0 "genomecov" to make a normalized count hg38 track which is the fraction of counts at each base pair scaled by the size of the hg38 reference sequence (3210038034) so that if the counts were uniformly distributed across the reference sequence there would be one at each position (Supplementary file .bw)
|
|
|
Submission date |
Feb 06, 2023 |
Last update date |
Jul 13, 2023 |
Contact name |
Jorja Henikoff |
E-mail(s) |
jorja@fhcrc.org
|
Phone |
206-667-4850
|
Organization name |
Fred Hutchinson Cancer Research Center
|
Department |
Basic Sciences
|
Lab |
Henikoff
|
Street address |
1100 Fairview AV N, A1-162
|
City |
Seattle |
State/province |
WA |
ZIP/Postal code |
98109-1024 |
Country |
USA |
|
|
Platform ID |
GPL30173 |
Series (1) |
GSE224579 |
Scalable single-cell profiling of chromatin modifications with sciCUT&Tag |
|
Relations |
BioSample |
SAMN33102940 |
SRA |
SRX19289078 |