|
| Status |
Public on Oct 04, 2023 |
| Title |
testis_hephGFP_spermatocyte_uH2A_rep10_(220421_JA_Dm_JA808) |
| Sample type |
SRA |
| |
|
| Source name |
CUT&Tag
|
| Organism |
Drosophila melanogaster |
| Characteristics |
cell type: sorted testis cells from heph-GFP testis dissociated with collagenase
antibody: uH2A Cell Signaling Technology 8240S
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
https://www.protocols.io/view/cut-amp-tag-direct-with-cutac-x54v9mkmzg3e/v3
CUT&Tag uses tagmentation in which the barcoded adapters are integrated on both sides of the insert, so that the DNA that is released is already a barcoded library. PMID:31036827
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
NextSeq 2000 |
| |
|
| Description |
FACS-CUT&Tag profiling uH2A in sorted spermatocytes from heph-GFP testis
|
| Data processing |
Genome_build: dm6
1. We used cutadapt 2.9 with parameters "-j 8 --nextseq-trim 20 -m 20 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT -Z" to trim adapters from 50bp paired-end reads. 2. We used Bowtie2 2.4.2 with options "--very-sensitive-local --soft-clipped-unmapped-tlen --dovetail --no-mixed --no-discordant -q --phred33 -I 10 -X 1000" to map the paired-end 50bp reads to the repeat-masked dm6 Drosophila melanogaster reference sequence obtained from UCSC. 3. We used samtools 1.14 "view" to extract properly paired reads from the D. melanogaster alignments. 4. We used bedtools 2.30.0 "genomecov" to make a normalized count dm6 track which is the fraction of counts at each base pair scaled by the size of the dm6 reference sequence (137567484) so that if the counts were uniformly distributed across the reference sequence there would be one at each position (Supplementary file .dm6.bw)
|
| |
|
| Submission date |
Feb 14, 2023 |
| Last update date |
Oct 04, 2023 |
| Contact name |
Jorja Henikoff |
| E-mail(s) |
jorja@fhcrc.org
|
| Phone |
206-667-4850
|
| Organization name |
Fred Hutchinson Cancer Research Center
|
| Department |
Basic Sciences
|
| Lab |
Henikoff
|
| Street address |
1100 Fairview AV N, A1-162
|
| City |
Seattle |
| State/province |
WA |
| ZIP/Postal code |
98109-1024 |
| Country |
USA |
| |
|
| Platform ID |
GPL30203 |
| Series (1) |
| GSE225300 |
Chromosome-specific maturation of the epigenome in the Drosophila male germline |
|
| Relations |
| BioSample |
SAMN33288472 |
| SRA |
SRX19365470 |
