 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Nov 05, 2023 |
| Title |
A.HepG2.40k.PTBP1.rep1 |
| Sample type |
SRA |
| |
|
| Source name |
Liver cancer cell line
|
| Organism |
Homo sapiens |
| Characteristics |
tissue: Liver cancer
cell line: HepG2
cell type: Liver cancer cells
genotype: WT
treatment: Rich Medium
cell number: 40,000
antibody: PTBP1 (CST, #57246)
|
| Treatment protocol |
For stress treatment, HeLa cells were changed into fresh pre-warmed medium supplemented with 5mM sodium arsenite and incubated at 37C, 5% CO2.
|
| Growth protocol |
HeLa or HepG2 cells were cultured in DMEM supplemented with 10% fetal bovine serum (FBS) and antibiotics. K562 cells were cultured in RPMI 1640 medium supplementec with 10% FBS, 2mM L-glutamine and antibiotics. All cells were placed in humidified atmosphere with 5% CO2 at 37C.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Cells were fixed with 1.5 % formaldehyde for 10 minutes, quenched with 125 mM glycine at room temperature for 5 min, and permeabilized with 0.5% Triton X-100 on ice for 10min. Samples were blocked with 1 mg/ml BSA, followed by staining with primary antibody, secondary antibody and protein A/G-reverse transcriptase. Then, the in-situ reverse transcription was preformed at 37C for 30min. RT-primer Cells were digested with proteinase K at 37C for 2h, and total nucleic acids were extracted with phenol-chloroform extraction and concentrated by ethanol precipitation.
Biotinylated cDNA were enriched by strepavidin beads. 3' cDNA adapter (5′Phos-NNNNNNNNAGATCGGAAGAGCGTCGTGT-3′SpC3) was ligated by T4 RNA ligase 1 by incubating at 25 °C for 16 h. cDNA was recovered from beads. Then, the library can be obtained by PCR amplification with NGS sequencing primer and gel purification of size between 180bp and 400bp.
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
NextSeq 550 |
| |
|
| Data processing |
The adaptor sequences were trimmed with Cutadapt (v4.2) using the parameter cutadapt --nextseq-trim=20 -a AGATCGGAAGAGCACACGTCTGAACTCCAG; the 8-nt UMI sequences were moved and add to the read name for the further deduplication. Especially for libraries in Groups D-G with 8-nt inline barcodes at the 5'-end of the 3'-end adaptors, extra 8 nts should be trimmed after adapter sequence removal. For all libraries, extra 4 nts at the reads’ 3-end were removed from the adapter-free sequence to minimize mapping mismatch caused by the imperfect paired sequence in the random primer.
The reads were first mapped to the corresponding rRNA sequences using Bowtie2 (v2.4.4) with parameters: --seedlen=15, and the mapped reads were discarded to avoid rRNA contamination.
The remaining unmapped reads were mapped to the corresponding genome using STAR (v2.7.9a) with parameters: --readFilesCommand zcat --alignEndsType EndToEnd --genomeLoad NoSharedMemory --quantMode TranscriptomeSAM --alignMatesGapMax 15000 --outFilterMultimapNmax 1 --outFilterMultimapScoreRange 1 --outSAMprimaryFlag AllBestScore --outSAMattributes All --outSAMtype BAM SortedByCoordinate --outFilterType BySJout --outReadsUnmapped Fastx --outFilterScoreMin 10 --outFilterMatchNmin 24.
Uniquely mapped reads were deduplicated to get the usable reads using UMI-tools with the parameter, --method unique (v1.1.2).
Assembly: GRCh38.p13, GRCm39
Supplementary files format and content: bigWig files for ARTR-seq libraries were generated by bamCoverage with the parameters-normalizeUsing BPM --binSize 1. The tab-delimited text files include read counts for sodium arsenite-treated samples counted by featureCounts.
Library strategy: ARTR-seq (an Assay of Reverse Transcription-based RBP binding sites Sequencing)
|
| |
|
| Submission date |
Feb 27, 2023 |
| Last update date |
Nov 06, 2023 |
| Contact name |
Yanming Chen |
| E-mail(s) |
yanmingchen@uchicago.edu
|
| Organization name |
The University of Chicago
|
| Street address |
929 E 57th Street
|
| City |
Chicago |
| ZIP/Postal code |
60637 |
| Country |
USA |
| |
|
| Platform ID |
GPL21697 |
| Series (1) |
| GSE226161 |
Profiling of RNA-binding protein binding sites by in-situ reverse transcription-based sequencing |
|
| Relations |
| BioSample |
SAMN33455529 |
| SRA |
SRX19512501 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM7065962_A.HepG2.40k.PTBP1.rep1.fwd.bw |
32.9 Mb |
(ftp)(http) |
BW |
| GSM7065962_A.HepG2.40k.PTBP1.rep1.rev.bw |
31.7 Mb |
(ftp)(http) |
BW |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
