GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM7068445

Query DataSets for GSM7068445

Status

Public on Apr 08, 2023

Title

HT1080-H4S47A+PUG-S4-IP

Sample type

SRA

Source name

Connective tissue

Organism

Homo sapiens

Characteristics

tissue: Connective tissue
cell line: HT1080
cell type: epithelial cell
genotype: H4S47A overexpression
treatment: PUGNAc

Extracted molecule

genomic DNA

Extraction protocol

HEK293T and HT1080 cells were cultured in the presence of 100 μM BrdU (sigma) for 2 h. To obtain four sub-populations of S phase cells, including S1, S2, S3 and S4, cells were fixed, stained with PI and sorted by FACS according to their DNA content. Next, isolated cells were lysed immediately in lysis buffer (50 mM Tris, pH 8.0, 10 mM EDTA, 1 M NaCl, 0.5% SDS, 0.1 mg/mL RNase A, 0.2 mg/mL Protease K) and incubated at 37 °C for 3 h, then at 55 °C for 8 h. Genomic DNA was extracted with phenol: chloroform: isoamyl (25:24:1) and chloroform: Isoamyl alcohol (24:1) and precipitated with 75% ethanol and 300 mM NaAc. DNA pellet was dissolved in TE (10 mM Tris, pH 8.0, 1 mM EDTA) before being sonicated using Bioruptor to 200-500 bp. The sonicated DNA was end-repaired, dA-tailed, and adapter-ligated. The adapter-ligated DNA was boiled for 10 min and cooled on ice immediately for 2 min. DNA solution was incubated with BrdU antibody (BD Bioscience, BD44) and rotated at 4 °C overnight. The mixture was incubated with protein G Dynabeads (Life Technology, 10009D) and rotated at 4 °C for another 8 h. After washing five times with washing buffer (PBS with 0.05% (v/v) Triton-X100) and once with TE, the beads were eluted by elution buffer (TE with 0.5% (w/v) SDS) at 65 °C for 10 min. After extraction with DNA Clean & Concentrator-5 kit (ZYMO, D4014), DNA was subjected to library amplification using Next Q5 Hot Start HiFi PCR Master Mix (NEB, M0543) and NEBNext Multiplex Oligos for Illumina (NEB, E7600). The libraries were purified with Ampure beads (0.9 ×) (Beckman, A633881) and sequenced using DNBSEQ-T7 platforms.

Library strategy

OTHER

Library source

genomic

Library selection

other

Instrument model

DNBSEQ-T7

Description

HT1080-H4S47A+PUG_target_qnor.Loess.bedGraph

Data processing

Paired-end reads were trimmed for adaptor sequence using cutadapt (Martin 2011) with parameters: -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT -e 0.1 -n 2 -m 35 -q 30 –pairfilter = any, and then mapped to hg38 using Bowtie2 (Langmead, Trapnell et al. 2009) with parameters: -I 10 -X 1000 -3 5 --local --no-mixed --no-discordant --no-unal. Duplicates were marked using picard MarkDuplicates (https://broadinstitute.github.io/picard/) with default parameters and removed using samtools view (Li, Handsaker et al. 2009) with parameters: -f 2 -F 1024 -q 10. Replication timing profile and timing domain were analyzed as described in (Ryba, Battaglia et al. 2011, Marchal, Sasaki et al. 2018). Briefly, in each 50 kb genome window, replication timing were calculated as log2((S1+S2)/(S3+S4))), then normalized with R function normalize.quantiles.use.target() from R package ‘preprocessCore’. The quantile normalized replication timing value were used for replication timing domain segmentation by R function CNA() from R package ‘DNAcopy’ and for timing domain annotation using HOMER (Heinz, Benner et al. 2010). Heatmap was produced using Java Treeview (Saldanha 2004). For IGV (Integrative Genomics Viewer) (Robinson, Thorvaldsdóttir et al. 2011) visualization, the normalized value was Loess-smoothed using R function loess() from R package ‘stats’.
Assembly: hg19, mm10
Supplementary files format and content: bedGraph
Library strategy: Repli-seq

Submission date

Feb 27, 2023

Last update date

Apr 08, 2023

Contact name

Liting Lan

E-mail(s)

lanliting21@mails.ucas.ac.cn

Organization name

University of Chinese Academy of Sciences

Department

Institute of biophysics