NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM7181917 Query DataSets for GSM7181917
Status Public on Jul 31, 2024
Title KD_CLSY3_Endosperm_sRNA_Rep2
Sample type SRA
 
Source name Endosperm
Organism Oryza sativa
Characteristics subspecies: Indica
cultivar: Pusa Basmati1 (PB1)
developmental stage: Endosperm (20 days after anthesis)
Treatment protocol WT and clsy3 knockdown lines were handled in the same manner.
Growth protocol The plants were grown in green house with natural day-night cycles with temperature maintained around 28 degrees celsius.
Extracted molecule total RNA
Extraction protocol Total RNA from endosperm was extracted using Trizol (Invitrogen) reagent.
Size fractionation. adaptor_seq TGGAATTCTCGGGTGCCAAGG
 
Library strategy ncRNA-Seq
Library source transcriptomic
Library selection size fractionation
Instrument model Illumina HiSeq 2500
 
Data processing Adapter was removed and low quality bases were trimmed from sequenced reads using UEA sRNA workbench. The sRNAs of appropriate size class(16-35nt) was chosen further.
The processed reads were aligned to the rice genome using Bowtie with one allowed mismatch.
Assembly: Oryza sativa japonica nipponbare genome – IRGSP1
Supplementary files format and content: Text delimited files showing the sequence and raw abundance of the sRNAs.
 
Submission date Apr 18, 2023
Last update date Jul 31, 2024
Contact name Shivaprasad Padubidri V.
E-mail(s) shivaprasad@ncbs.res.in, epigeneticsncbsindia@gmail.com, harshith200cy@gmail.com
Phone +91-80-2366-6511
Organization name National Centre for Biological Sciences - TIFR
Street address UAS-GKVK Campus
City Bangalore
ZIP/Postal code 560065
Country India
 
Platform ID GPL19290
Series (1)
GSE229958 Upstream regulator of genomic imprinting in rice is a small RNA-associated chromatin remodeler [ncRNA-Seq]
Relations
BioSample SAMN34234241
SRA SRX20001557

Supplementary file Size Download File type/resource
GSM7181917_KD_CLSY3_Endosperm_sRNA_Rep2.fa.gz 25.4 Mb (ftp)(http) FA
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap
External link. Please review our privacy policy.