|
| Status |
Public on Jul 24, 2023 |
| Title |
40290F iPSC, WT control, replicate 1 |
| Sample type |
SRA |
| |
|
| Source name |
Pluripotent stem cells
|
| Organism |
Pan troglodytes |
| Characteristics |
tissue: Pluripotent stem cells
cell line: 40290F
cell type: induced pluripotent stem cells
genotype: WT
treatment: Growth in StemFlex media
|
| Growth protocol |
Pluripotent stem cells were maintained in StemFlex media and Accutase passaged with ROCK inhibitor
|
| Extracted molecule |
total RNA |
| Extraction protocol |
High quality RNA was extracted by adding RNAse-free Trizol to each pellet and processing with the Zymo Research Direct-zol RNA miniprep kit
RNA-seq library prep was performed using the Illumina TruSeq Stranded Total RNA kit .
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Data processing |
Adapters were removed using cutadapt with option -b AGATCGGAAGAGCACACGTCTGAACTCCAGTCA)
Reads were then pseudo-aligned to species-specific transcriptomes using kallisto with options --single -l 200 -s 20
Transcriptomes were extracted from species-specific gtf annotations using the gffread utility using the -w output option
Human transcripts were obtained from the Gencode comprehensive gene annotation v36 (GTF), using genome assembly hg38.
Chimpanzee annotations were obtained from a recent study that produced a hierarchical alignment of primate genome assemblies and annotated the assemblies using the Comparative Annotation Toolkit
Assembly: hg38
Supplementary files format and content: tab-delimited text files are VST-transformed counts for each sample
Supplementary files format and content: using the function vst with option blind=TRUE and ran the DESeq linear model fitting using the function DESeq with betaPrior=TRUE
|
| |
|
| Submission date |
Apr 26, 2023 |
| Last update date |
Jul 24, 2023 |
| Contact name |
Richard She |
| Organization name |
Whitehead Institute
|
| Lab |
Weissman Lab
|
| Street address |
455 Main St Rm 639, Whitehead Institute
|
| City |
Cambridge |
| State/province |
Massachusetts |
| ZIP/Postal code |
02142 |
| Country |
USA |
| |
|
| Platform ID |
GPL19148 |
| Series (1) |
| GSE212297 |
Comparative landscape of genetic dependencies in human and chimpanzee stem cells |
|
| Relations |
| BioSample |
SAMN34376044 |
| SRA |
SRX20102277 |
