|
Status |
Public on Jul 24, 2023 |
Title |
8861G iPSC, WT control, replicate 1 |
Sample type |
SRA |
|
|
Source name |
Pluripotent stem cells
|
Organism |
Pan troglodytes |
Characteristics |
tissue: Pluripotent stem cells cell line: 8861G cell type: induced pluripotent stem cells genotype: WT treatment: Growth in StemFlex media
|
Growth protocol |
Pluripotent stem cells were maintained in StemFlex media and Accutase passaged with ROCK inhibitor
|
Extracted molecule |
total RNA |
Extraction protocol |
High quality RNA was extracted by adding RNAse-free Trizol to each pellet and processing with the Zymo Research Direct-zol RNA miniprep kit RNA-seq library prep was performed using the Illumina TruSeq Stranded Total RNA kit .
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
cDNA |
Instrument model |
Illumina HiSeq 2500 |
|
|
Data processing |
Adapters were removed using cutadapt with option -b AGATCGGAAGAGCACACGTCTGAACTCCAGTCA) Reads were then pseudo-aligned to species-specific transcriptomes using kallisto with options --single -l 200 -s 20 Transcriptomes were extracted from species-specific gtf annotations using the gffread utility using the -w output option Human transcripts were obtained from the Gencode comprehensive gene annotation v36 (GTF), using genome assembly hg38. Chimpanzee annotations were obtained from a recent study that produced a hierarchical alignment of primate genome assemblies and annotated the assemblies using the Comparative Annotation Toolkit Assembly: hg38 Supplementary files format and content: tab-delimited text files are VST-transformed counts for each sample Supplementary files format and content: using the function vst with option blind=TRUE and ran the DESeq linear model fitting using the function DESeq with betaPrior=TRUE
|
|
|
Submission date |
Apr 26, 2023 |
Last update date |
Jul 24, 2023 |
Contact name |
Richard She |
Organization name |
Whitehead Institute
|
Lab |
Weissman Lab
|
Street address |
455 Main St Rm 639, Whitehead Institute
|
City |
Cambridge |
State/province |
Massachusetts |
ZIP/Postal code |
02142 |
Country |
USA |
|
|
Platform ID |
GPL19148 |
Series (1) |
GSE212297 |
Comparative landscape of genetic dependencies in human and chimpanzee stem cells |
|
Relations |
BioSample |
SAMN34376041 |
SRA |
SRX20102280 |