 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on May 08, 2024 |
| Title |
A375_DMSO_R2 |
| Sample type |
SRA |
| |
|
| Source name |
A375
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: A375
cell type: skin melanoma
treatment: DMSO for 24h
|
| Treatment protocol |
For the glutamine depletion experiment, the medium was not supplemented with glutamine. For the MAPK inhibitors treatment , cells were plated and the following day, the culture medium was removed and replaced with fresh medium containing vemurafenib and cobimetinib. Cells were treated for 24h at 1µM (500nM vemurafenib + 500nM cobimetinib).
|
| Growth protocol |
A375 cells were obtained from ATCC and cultured in DMEM containing all amino-acids except glutamine (Gibco, 10938025) and supplemented with 10% FBS, 2mM glutamine and penicillin-streptomycin, at 37°C and 5% CO2. Cells were passed at around 80% confluency, 3 times a week.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Cells were washed twice with ice cold PBS, then scrapped with 1ml of PBS supplemented with 100µg/ml cycloheximide (Sigma, 01810). Then they were centrifuged (500g for 1min at 4°C) and slowly resuspended in 1ml of lysis buffer (10mM Tris-HCL pH7.5; 5mM MgCl2; 100 mM KCl; 1% Triton X-100) , and incubated on ice for 10 minutes. The PBS and lysis buffer were supplemented with 100µg/ml cycloheximide (Sigma, 01810) and 2mM DTT the day of use. 260nm absorbance of the lysate was measured to estimate the total quantity of material and then subjected to nuclease digestion. For 5 units of A260 absorbance, 6µl of MNase (Nuclease S7 10107921001, Roche, 1mg/ml) were added to the lysate, along with CaCl2 to a final concentration of 10mM. The tubes were then incubated at 25°C for 30 minutes and transferred on ice, and the digested lysates were then carefully laid on top of 10%-50% sucrose gradients containing cycloheximide (100µg/ml). The gradients were then ultra-centrifuged at 35,000 rpm for 2h40min at 4°C and run on a fraction collector. The fractions containing the digested monosome fragments (80S) were kept and SDS was added to a final concentration of 1%, before the digestion with proteinase K (Roche, 03115828001, final concentration of 2µg/ml) for 45min at 42°C. Protected RNA fragments were then purified using an acidic phenol-chloroform extraction (Fischer, BP1753I) and precipitated overnight at -20°C with 0.1x volume of sodium acetate (3 M, pH 5.2), 1x vol isopropanol, 1µl GlycoBlue and 10mM MgCl2 (use 10mM MgCl2 at every precipitation step, helps to recover smaller nucleic acids). Purified RNA fragments were then 3’-end dephosphorylated using PNK and run on a 10% acrylamide denaturing gel, and smears of interest (26-32bp) were cut from the gel and purified. Size-selected fragments were then rRNA-depleted by hybridization using RNA probes, and successively RNAse H and DNAse-treated, and purified with a new phenol-chloroform extraction before the Omniprep Library preparation.
Ribosome profiling Omniprep libraries were sequenced by GenomEast (Hiseq 4000 1x50bp).
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina HiSeq 4000 |
| |
|
| Description |
sequencing batch #2
|
| Data processing |
Adapters were removed from raw reads using cutadapt version 2.1 (parameters -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -u 13 --maximum-length=40 --minimum-length=20 -q 28,28)
Reads were trimmed using UrQt version 1.0.18
Reads were mapped to GRCh38.p13 coding genes using hisat2 version 2.2.1 (parameters parameters --rna-strandness 'F' –norc).
Alignment files were converted, with deeptools version 3.0.2, to bigWig files containing CPM (count per million mapped reads) normalized coverage at one nucleotide resolution
Assembly: GRCH38.p13
Supplementary files format and content: Bigwig files containing the ribosome footprints CPM normalized coverage at one nucleotide resolution for each sample
|
| |
|
| Submission date |
May 15, 2023 |
| Last update date |
May 08, 2024 |
| Contact name |
Nicolas Fontrodona |
| Organization name |
ENS de Lyon
|
| Lab |
Laboratory of Biology and Modeling of the Cell
|
| Street address |
46 allée d'Italie
|
| City |
Lyon |
| ZIP/Postal code |
69007 |
| Country |
France |
| |
|
| Platform ID |
GPL20301 |
| Series (2) |
| GSE232551 |
Metabolism-dependent secondary effect of anti-MAPK cancer therapy on DNA repair [glutamine] |
| GSE232711 |
Metabolism-dependent secondary effect of anti-MAPK cancer therapy on DNA repair |
|
| Relations |
| BioSample |
SAMN35090293 |
| SRA |
SRX20348593 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM7350164_DMSO_246.bw |
17.2 Mb |
(ftp)(http) |
BW |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
