|
Status |
Public on Dec 31, 2023 |
Title |
B2x2_H_Nira_r2 |
Sample type |
SRA |
|
|
Source name |
WIBR3
|
Organism |
Homo sapiens |
Characteristics |
cell line: WIBR3 cell type: Embryonic stem cells (ESCs) genotype: BRCA2 loHAPs treatment: Niraparib
|
Treatment protocol |
Drug sensitivity screening was started on day 21 with at least 0.3 million cells were used in each replicate, and cells were collected on day 28.
|
Growth protocol |
Human pluripotent cells were cultured on 4.1x105/cm2 irradiated mouse embryonic fibroblasts (MEF) in hPSC medium (Dulbecco's Modified Eagle Medium/Nutrient Mixture F-12 (DMEM/F12), 20% KnockOut Serum Replacement (KOSR), 1x Non-Essential Amino Acids (NEAA), 1mM Glutamine, 1x penicillin/streptomycin, 0.1mM ß-mercaptoethanol and 4 ng/ml heat-stable basic FGF). The culture medium was changed daily, and cells were passaged with 1mg/ml collagenase IV every 5-7 days. The day before and after passage, the medium was supplemented with 10µM Y27632 (CD0141, Chemdea) to increase cell survival.
|
Extracted molecule |
other |
Extraction protocol |
Phenol-chloroform extraction for genomic DNA Using primers containing NGS barcode attachment sites (GCTCTTCCGATCT), the mutagenized regio was amplified with GXL DNA polymerase. Amplicons were then purified using an automated SPRI beads purification protocol at the UC Berkeley DNA Sequencing Facility, i5/i7 barcoded and pooled.
|
|
|
Library strategy |
OTHER |
Library source |
other |
Library selection |
other |
Instrument model |
Illumina NovaSeq 6000 |
|
|
Description |
PE250
|
Data processing |
Raw sequencing files were demultiplexed on Illumina BaseSpace. Sequencing reads were trimed to 150bp. Reads were aligned to reference amplicon sequences and quantifiled with CRISPResso2. Assembly: BRCA2 exon 2 reference sequence, ttccagcgcttctgagttttacctcagtcacataataaggaatgcatccctgtgtaagtgcattttggtcttctgttttgcagacttatttaccaagcattggaggaatatcgtaggtaaaaatgcctattggatccaaagagaggccaacattttttgaaatttttaagacacgctgcaacaaagcaggtattgacaaattttatataactttataaattacaccgagaaagtgttttctaaaaaatgcttgctaaaaacccagtacgtcaca; BRCA2 exon 27 reference sequence, tgtaaaggggagaaagagattgatgaccaaaagaactgcaaaaagagaagagccttggatttcttgagtagactgcctttacctccacctgttagtcccatttgtacatttgtttctccggctgcacagaaggcatttcagccaccaaggagttgtggcaccaaatacgaaacacccataaagaaaaaagaactgaattctcctcagatgactccatttaaaaaattcaatgaaatttctcttttggaaagtaattcaatagctgacgaagaacttgc Supplementary files format and content: plain text, aligned allele sequences and quantification Library strategy: Amplicon sequencing
|
|
|
Submission date |
May 30, 2023 |
Last update date |
Dec 31, 2023 |
Contact name |
Dirk Hockemeyer |
E-mail(s) |
hockemeyer@berkeley.edu
|
Phone |
510-664-9851
|
Organization name |
University of California, Berkeley
|
Department |
Department of Molecular & Cell Biology
|
Street address |
400 Li Ka Shing Center
|
City |
Berkeley |
State/province |
CA |
ZIP/Postal code |
94720-3370 |
Country |
USA |
|
|
Platform ID |
GPL24676 |
Series (1) |
GSE233683 |
Functional annotation of genetic variants using locally haploid human pluripotent stem cells |
|
Relations |
BioSample |
SAMN35525733 |
SRA |
SRX20536741 |