 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Sep 28, 2023 |
| Title |
Chlamydomonas reinhardtii liquid culture total RNA-seq r1 |
| Sample type |
SRA |
| |
|
| Source name |
liquid culture
|
| Organism |
Chlamydomonas reinhardtii |
| Characteristics |
tissue: liquid culture
treatment: none
|
| Treatment protocol |
N/A
|
| Growth protocol |
A.thaliana Col-0 mature leaves were collected from plants grown as described (M. Wang et al. 2023), while A.thaliana Col-0 suspension cells were grown in 250-mL baffled flasks containing 50 mL of growth medium (3.2 g/L Gamborg’s B-5 medium, 3 mM MES, 3% [v/v] Suc, 1.1 mg L−1 2,4-dichlorophenoxyacetic acid). The cultures were maintained at 23°C under continuous light on a rotary shaker (160 rpm) and kindly provided as a frozen pellet by Dr. Ashley M. Brooks. Barley (Hordeum vulgare) RNA was isolated by Dr. Pete Hedley from embryonic tissue (including mesocotyl and seminal roots; EMB) isolated from grain tissues 4 days past germination (Mascher et al. 2017). Physcomitrium (Physcomitrella) patens (Gransden) was grown on plates with BCDA medium in a growth cabinet at 21°C under 16h light. Selaginella moellendorffii was purchased from Plant Delights Nursery and grown at the window under normal daylight for 1 week prior to isolating RNA from stems and leaves. C. reinhardtii, which was kindly provided by Dr. Will Ansari and Dr. Stephen Mayfield (UC San Diego), was grown to late logarithmic phase in TAP (Tris–acetate–phosphate) medium at 23°C under constant illumination of 5000 lux on a rotary shaker. Adult 2nd and 3rd leaves from Z. mays L. cultivar B73 was kindly provided by Dr. Lauri Smith (UC San Diego). Plants were grown in 4-inch pots in a greenhouse (temp: 23°C-29°C) without supplemental lighting or humidification (humidity in the 15 hours following inoculation ranged between 70 and 90%) year round in La Jolla, CA. RNA from Z. mays L. cultivar B73 7d old shoot, root and leaves were grown in the Schmitz laboratory (University of Georgia) as described in (Ricci et al. 2019).
|
| Extracted molecule |
total RNA |
| Extraction protocol |
csRNA-seq was performed as described in (S. H. Duttke et al. 2019). Small RNAs of ~20-60 nt were size selected from 0.4-3 µg of total RNA by denaturing gel electrophoresis. A 10% input sample was taken aside and the remainder enriched for 5’-capped RNAs. Monophosphorylated RNAs were selectively degraded by 1 hour incubation with Terminator 5´-Phosphate-Dependent Exonuclease (Lucigen). Subsequently, RNAs were 5’dephosporylated through 90 minutes incubation in total with thermostable QuickCIP (NEB) in which the samples were briefly heated to 75°C and quickly chilled on ice at the 60 minutes mark. Input (sRNA) and csRNA-seq libraries were prepared as described in (Hetzel et al. 2016) using RppH (NEB) and the NEBNext Small RNA Library Prep kit, amplified for 11-14 cycles. Total RNA-Seq Library Preparation Strand-specific, paired-end libraries were prepared from total RNA by ribosomal depletion using the Ribo-Zero Gold plant rRNA removal kit (Illumina, San Diego, CA). Samples were processed following the manufacturer’s instructions.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina NovaSeq 6000 |
| |
|
| Description |
total RNA-seq (Ribo0), steady state transcriptome profiling in C.reinhardtii leaf; Experiment SD541
C.reinhardtii-10.tss.txt
|
| Data processing |
csRNA-seq (small capped RNAs, ~20-60 nt) and sRNA-seq reads (“input”) were trimmed of their adapter sequences using HOMER (“homerTools trim -3 AGATCGGAAGAGCACACGTCT -mis 2 -minMatchLength 4 -min 20" none -f {csRNA_fastq_path}/*fastq.gz”)(Heinz et al. 2010). Reads were aligned to the appropriate genome using Hisat2 version 2.2.1 (Kim et. al. 2019) with parameters “hisat2 -p 30 --rna-strandness RF --dta -x {hisat2_genome_index} -U {path_rimmed_csRNA or sRNA} -S {output_sam} 2> {mapping_stats}”. Hisat2 indices were then created for each genome used ("hisat2-build -p 40 genome.dna.toplevel.fa {Hisat2_indexfolder}") with exception for barely which required the addition of "--large-index" due to genome size. Tag directory folders were then created using HOMER makeTagDirectories ("makeTagDirectories {outputName} -omitSN -checkGC -fragLength 150 -single")(Heinz et. al. 2010). Only reads with a single, unique alignment (MAPQ >=10) were considered in the downstream analysis. This consolidates the aligned read information into a read/chromosome format along with other important alignment information. Peaks were called and annotated using HOMER ("findcsRNATSS.pl {csRNA} -o {output} -i {sRNA} -genome hg38 -size 150 -ntagThreshold 10") (Duttke et al. 2019) and annotatePeaks.pl ("annotatePeaks.pl {tss/tsr.txt} hg38 -strand + -fragLength 1 -rlog -d {listOfTagDirs} > {output}") (Heinz et. al. 2010) respectively (additional details available in the manuscript).
Transcription start sites (TSSs) and Transcription start regions (TSRs) were determined in this study. TSRs were called using findcsRNATSS.pl (detailed above) while TSSs were called using getTSSfromReads.pl ("getTSSfromReads.pl -d {csRNA_tagdir} -dinput {sRNA_tagdir} -min 7 > {output_file}") (Heinz et. al. 2010). To ensure high quality TSSs, at least 7 per 10^7 aligned reads were required and TSS were required to be within called TSR regions.
Paired end total ribosomal RNA-depeleted RNA-seq libraries were trimmed using skewer (“time -p skewer -m mp {read1} {read2} -t 40 -o {trimmed_fastq_output}”) (Jiang et al. 2014) and aligned using Hisat2 (Kim et al. 2019) to ensure all data were processed as similar as possible (“hisat2 -p 30 --rna-strandness RF --dta -x {hisat2_index} -1 {trimmed_RNAseq_R1} -2 {trimmed_RNAseq_R2} -S {output_sam} 2> {mapping_file}”). In this manuscript, total RNA-seq was exclusively used to determine RNA-stability as described in the csRNA-seq analysis.
5’GRO-seq peaks were called using HOMER’s “findPeaks {5GRO_tagdirectory} -i {GRO_tagdirectory} -style tss -F 3 -P 1 -L 2 -LP 1 -size 150 -minDist 200 -ntagThreshold 10 > 5GRO_TSRs.txt”. Detailed explanation of each parameter can be found at http://homer.ucsd.edu/homer/ngs/tss/index.html.
Assembly: TAIR10, Papaya1.0, Chlamydomonas_reinhardtii_v5.5, Drosophila melanogaster: dm6, ASM32608v1, Phypa V3, Selaginella moellendroffii: v1.0, Zea mays (rest): Zm-B73-REFERENCE-NAM-5.0, Zea mays : AGPv4.38 (STARR-seq)
Supplementary files format and content: bed files: Locations indicate TSS positions. TSS.txt files: text files containing tab delimited information about found transcription start site culsters (TSRs). Motif file containing new line delimited motifs. Motif files: files containing motifs used with a ‘>’ indicating motif information followed by rows with nucleotide probability.
|
| |
|
| Submission date |
Jun 01, 2023 |
| Last update date |
Sep 28, 2023 |
| Contact name |
Sascha Duttke |
| Organization name |
Washington State University
|
| Department |
School of Molecular Biosciences
|
| Lab |
Dr. Duttke Lab
|
| Street address |
BLS 202, 100 Dairy Road
|
| City |
Pullman |
| State/province |
Washington |
| ZIP/Postal code |
99163 |
| Country |
USA |
| |
|
| Platform ID |
GPL29113 |
| Series (1) |
| GSE233927 |
Comparative analysis of nascent transcription among plant species |
|
| Relations |
| BioSample |
SAMN35559898 |
| SRA |
SRX20570363 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM7439232_C.reinhardtii_total_RNA-seq_r1.bed.gz |
31.2 Mb |
(ftp)(http) |
BED |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
| Processed data are available on Series record |
|
|
|
|
 |
