|
| Status |
Public on Jan 25, 2024 |
| Title |
TYG-Bile salts, R1 |
| Sample type |
SRA |
| |
|
| Source name |
Bacteria
|
| Organism |
Bacteroides thetaiotaomicron |
| Characteristics |
strain: VPI-5482
cell type: Bacteria
genotype: WT
condition: Stress condition
|
| Growth protocol |
Growth assays in the presence of diverse carbon sources were carried out in minimal medium (MM), supplemented with 0.5% of a suitable carbon source. Stress response assays were performed in TYG medium containing the indicated concentration of a stressor and incubated for a further 2 h. MS2 affinity purification was performed on cultures grown in TYG medium until an OD of 2.0, followed by 2 h incubation with inducer, anhydrotetracycline (aTC).
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total RNA was isolated by the hot phenol method. Traces of genomic DNA were removed by treatment with DNase I (Fermentas) and Superase-In RNase Inhibitor (Ambion)
For conventional RNA-seq, libraries were prepared with the NEBNext Multiplex Small RNA Library Prep kit for Illumina according to the manufacturer’s instructions. For differential RNA-seq (dRNA-seq) and MS2 affinity purification and sequencing, libraries were prepared with the TruSeq Library Prep kit for Illumina.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Description |
Cutadapt_on_3_11.fq.gz.fastqsanger (column name in RNAseq_counts.csv)
|
| Data processing |
Generated reads were quality-checked using FastQC (v0.11.8) and adapters were trimmed using Cutadapt (v1.16) with Python (v3.6.6), using the following parameters: -j 6 -a Illumina Read 1 adapter=AAGATCGGAAGAGCACACGTCTGAACTCCAGTCA -a Poly A=AAAAAAAAAAA --output=out1.fq.gz --error-rate=0.1 --times=1 --overlap=3 --minimum-length=20 --nextseq-trim=20 3_1.
For the both sequencing data types (dRNA-seq and conventional RNA-seq), READemption (v0.4.5) was used to map reads.
ANNOgesic pipeline (v0.7.33) was used to annotate transcriptomic features prior to manual curation.
Assembly: B. thetaiotaomicron VPI-5482 reference genome (NC_004663.1) and plasmid (NC_004703.1)
Supplementary files format and content: Count tables as excel files
|
| |
|
| Submission date |
Jun 14, 2023 |
| Last update date |
Jan 25, 2024 |
| Contact name |
Alexander J. Westermann |
| E-mail(s) |
alexander.westermann@helmholtz-hiri.de
|
| Organization name |
Helmholtz Institute for RNA-based Infection Research (HIRI), Helmholtz Centre for Infection Research (HZI),
|
| Street address |
Josef-Schneider-Straße 2/D15
|
| City |
Würzburg |
| ZIP/Postal code |
97080 |
| Country |
Germany |
| |
|
| Platform ID |
GPL28094 |
| Series (1) |
| GSE234958 |
An expanded transcriptome atlas for Bacteroides thetaiotaomicron reveals a small RNA that modulates tetracycline sensitivity |
|
| Relations |
| BioSample |
SAMN35739708 |
| SRA |
SRX20683779 |
