 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jun 27, 2023 |
| Title |
Tyg bile salts, replicate 3 |
| Sample type |
SRA |
| |
|
| Source name |
bacterial culture
|
| Organism |
Bacteroides thetaiotaomicron |
| Characteristics |
tissue: bacterial culture
strain: VPI-5482
treatment: Rich medium (TYG) + 0.5 mg/mL bile salts
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
After end-repair, TruSeq sequencing adapters were ligated to the DNA fragments. Finally, the DNA was PCR-amplified to about 10-20 ng/μl using a high fidelity DNA polymerase. The PCR amplified samples were purified using the Agencourt AMPure XP kit (Beckman Coulter Genomics) and were analyzed by capillary electrophoresis
We incubated the culture at 37°C until it reached the indicated OD, at which point we took a 2 mL aliquot, pelleted it, discarded the supernatant, and stored the bacterial samples at -20°C until further processing. Bacterial pellets were resuspended in 100 μL of PBS containing 250 μg lysozyme, mixed with 100 μL lysis buffer (100 mM Tris-HCl pH 8.5, 200 mM NaCl, 0.2% SDS, 5 mM EDTA), and lysed by incu-bating at 37°C for 5 min. Proteins were then degraded by addition of 1 μL of Proteinase K (NEB #P8107) and incubation at 56°C for 30 min, following which RNA was digested with 0.5 μL of RNase A (Thermo #EN0531) and incubation at 56°C for 5 min. The remaining gDNA was purified from each sample via phenol-chloroform extraction, followed by ethanol precipitation. The genomic regions coding for gRNAs and arrays were PCR-amplified in a 50 µL reaction con-taining 100 ng gDNA with oligonucleotides AWO-577/AWO-578 (annealing temperature: 55°C) and AWO-575/AWO-576 (annealing temperature: 63°C).
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Data processing |
Sequenced reads were adapter- and quality- trimmed with BBDuk, using the following parameters: k=13 mink=5 rcomp=t lit-eral=ACACTCTTTCCCTACACGACGCTCTTCCGATCT,GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT hdist=1 ktrim=r minlen=100 tbo. Trimmed reads were merged with BBMerge, using parameters mininsert=120 maxloose=t. The abundance of each CRISPRi mutant within the merged reads was determined with a custom Python script.
Assembly: Custom reference of all designed gRNA/array sequences.
Supplementary files format and content: Tab separated file of gRNA/array name and read count
Library strategy: DNA-seq
|
| |
|
| Submission date |
Jun 22, 2023 |
| Last update date |
Jun 27, 2023 |
| Contact name |
Alexander J Westermann |
| Organization name |
Helmholtz Institute for RNA-based Infection Research (HIRI)
|
| Street address |
Josef Schneider Strasse , D15
|
| City |
Wuerzburg |
| ZIP/Postal code |
97080 |
| Country |
Germany |
| |
|
| Platform ID |
GPL28094 |
| Series (1) |
| GSE235620 |
CRISPR-based screening of small RNA modulators of bile susceptibility in Bacteroides thetaiotaomicron |
|
| Relations |
| BioSample |
SAMN35848900 |
| SRA |
SRX20759749 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM7506310_bile_stat_3_counts.txt.gz |
3.6 Kb |
(ftp)(http) |
TXT |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
