|
| Status |
Public on Jul 15, 2023 |
| Title |
TSS tur1delta 30E rep 1 |
| Sample type |
SRA |
| |
|
| Source name |
NE1602
|
| Organism |
Cryptococcus neoformans |
| Characteristics |
cell line: NE1602
genotype: tur1delta
|
| Growth protocol |
Cells were grown on YPD at 30°C in exponential phase. The Cryptococcus cell preparation was spiked in with one tenth (OD/OD) of S. cerevisiae strain FY834 cells grown in YPD at 30°C in exponential phase.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
none provided
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
NextSeq 550 |
| |
|
| Data processing |
Single 50 bases single end reads were obtained using an an Illumina Nextses500 instrument according to the manufacturer’s instructions
For TSS analysis we kept only the reads containing both the oligo 3665 (AGATCGGAAGAGCACACGTCTGAAC) and the 11NCGCCGCGNNN tag. These sequenced were removed using cutadapt/1.18 and the trimmed reads were mapped to the Cryptococcus neoformans H99 genome using Tophat2 using previously published setting (Gonzalez-Hilarion et al Sci Rep 2016). Wig files were constructed using the 5’ extremities of each reads. Their coverage was normalized using the normalization factor used for spiked in RNA-Seq.
|
| |
|
| Submission date |
Jul 13, 2023 |
| Last update date |
Jul 15, 2023 |
| Contact name |
Guilhem Janbon |
| E-mail(s) |
janbon@pasteur.fr
|
| Organization name |
Institut Pasteur
|
| Street address |
25 rue du Dr Roux
|
| City |
Paris |
| ZIP/Postal code |
75015 |
| Country |
France |
| |
|
| Platform ID |
GPL33584 |
| Series (1) |
| GSE237320 |
Tur1 regulates alternative TSS usage in Cryptococcus |
|
| Relations |
| BioSample |
SAMN36439103 |
| SRA |
SRX21012744 |
