NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM7698794 Query DataSets for GSM7698794
Status Public on Aug 30, 2024
Title Moffat_47_BT972_AAVS1_R2
Sample type SRA
 
Source name glioblastoma
Organism Homo sapiens
Characteristics tissue: glioblastoma
cell line: tumor-derived cell line
cell type: recurrent GBM
treatment: Transduced with AAVS1-targeting sgRNA (GGGGCCACTAGGGACAGGAT) in lentiCRISPRv2.
Treatment protocol CRISPR-edited cells were transduced with AAVS1- or PTP4A2-targeting sgRNAs, selected with puromycin, and cultured as indicated prior to RNA extraction.
Growth protocol Cells were cultured in Neurocult Complete media supplemented with 1X antibiotic/antimycotic. Cells were pelletted for RNA extraction and quantification by next-generation sequencing.
Extracted molecule total RNA
Extraction protocol Total RNA was isolated from cultured GBM cells using Norgen total RNA purification kit following the manufacturer's instructions.
Directional RNA libraries were prepared using the NEBNext Ultra II library prep kits using either standard protocols.
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection cDNA
Instrument model Illumina NovaSeq 6000
 
Data processing FASTQ files were first filtered using a bespoke Perl script to remove reads shorter than 36bp.
Filtered FASTQ files were aligned to Gencode v25 gene annotations and hg38 genome build using the STAR short-read aligner (v2.4.2a)
Read count files generated by STAR were merged with gene annotations in R
Assembly: hg38
Supplementary files format and content: tab-delimited text read counts
 
Submission date Aug 09, 2023
Last update date Aug 30, 2024
Contact name Jason Moffat
E-mail(s) jason.moffat@sickkids.ca
Organization name Hospital for Sick Children
Department Genetics and Genome Biology
Lab Moffat
Street address 686 Bay Street
City Toronto
State/province Ontario
ZIP/Postal code M5G0A4
Country Canada
 
Platform ID GPL24676
Series (2)
GSE240490 Functional mapping of Glioblastoma recurrence reveals targetable dependencies in an axonal guidance pathway in lethal brain cancers [RNA-seq]
GSE240492 Functional mapping of Glioblastoma recurrence reveals targetable dependencies in an axonal guidance pathway in lethal brain cancers
Relations
BioSample SAMN36919978
SRA SRX21320929

Supplementary file Size Download File type/resource
GSM7698794_Moffat_47_BT972_AAVS1_R2_readCounts.txt.gz 285.8 Kb (ftp)(http) TXT
SRA Run SelectorHelp
Raw data are available in SRA
Processed data are available on Series record
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap