|
Status |
Public on Aug 30, 2024 |
Title |
Moffat_47_BT972_AAVS1_R2 |
Sample type |
SRA |
|
|
Source name |
glioblastoma
|
Organism |
Homo sapiens |
Characteristics |
tissue: glioblastoma cell line: tumor-derived cell line cell type: recurrent GBM treatment: Transduced with AAVS1-targeting sgRNA (GGGGCCACTAGGGACAGGAT) in lentiCRISPRv2.
|
Treatment protocol |
CRISPR-edited cells were transduced with AAVS1- or PTP4A2-targeting sgRNAs, selected with puromycin, and cultured as indicated prior to RNA extraction.
|
Growth protocol |
Cells were cultured in Neurocult Complete media supplemented with 1X antibiotic/antimycotic. Cells were pelletted for RNA extraction and quantification by next-generation sequencing.
|
Extracted molecule |
total RNA |
Extraction protocol |
Total RNA was isolated from cultured GBM cells using Norgen total RNA purification kit following the manufacturer's instructions. Directional RNA libraries were prepared using the NEBNext Ultra II library prep kits using either standard protocols.
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
cDNA |
Instrument model |
Illumina NovaSeq 6000 |
|
|
Data processing |
FASTQ files were first filtered using a bespoke Perl script to remove reads shorter than 36bp. Filtered FASTQ files were aligned to Gencode v25 gene annotations and hg38 genome build using the STAR short-read aligner (v2.4.2a) Read count files generated by STAR were merged with gene annotations in R Assembly: hg38 Supplementary files format and content: tab-delimited text read counts
|
|
|
Submission date |
Aug 09, 2023 |
Last update date |
Aug 30, 2024 |
Contact name |
Jason Moffat |
E-mail(s) |
jason.moffat@sickkids.ca
|
Organization name |
Hospital for Sick Children
|
Department |
Genetics and Genome Biology
|
Lab |
Moffat
|
Street address |
686 Bay Street
|
City |
Toronto |
State/province |
Ontario |
ZIP/Postal code |
M5G0A4 |
Country |
Canada |
|
|
Platform ID |
GPL24676 |
Series (2) |
GSE240490 |
Functional mapping of Glioblastoma recurrence reveals targetable dependencies in an axonal guidance pathway in lethal brain cancers [RNA-seq] |
GSE240492 |
Functional mapping of Glioblastoma recurrence reveals targetable dependencies in an axonal guidance pathway in lethal brain cancers |
|
Relations |
BioSample |
SAMN36919978 |
SRA |
SRX21320929 |