 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Apr 01, 2024 |
| Title |
Wt_r2_DNA_gel |
| Sample type |
SRA |
| |
|
| Source name |
cells
|
| Organism |
Escherichia coli K-12 |
| Characteristics |
tissue: cells
biological replicate: 2
sample type: condensate derived DNA
genotype: wild-type with hfq-mcherry
treatment: N-24 nitrogen starvation
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Gel-extracted DNA corresponding to the polyP dependent, Hfq-associated high molecular weight fraction on native gels was recovered by crushing the gel slice with a pipette tip, adding 200 microliters of PAGE elution buffer (0.5 M ammonium chloride, 0.03 M sodium acetate, 5 mM EDTA, 0.1% Tween20) and incubating for 6 hours at 37 C with shaking. At the end of the incubation, the sample was centrifuged 1 minute at 16,100xg at 4 C, and then an additional 100 microliters of PAGE elution buffer was added and vortexed, and the supernatant combined with the additional 200 microliter eluate. 600 microliters of ice cold ethanol were added to each sample, followed by overnight incubation at -80 C to precipitate the DNA. After precipitation, the DNA was recovered by spinning 10 minutes at 16,100xg at 4 C, washing the pellet with 1 mL 95% ethanol, re-spinning, and then removing all ethanol from the pellet and allowing it to dry. The pellet was then resuspended in 200 microliters TE (pH 7.5). Half of the recovered material was treated with RNase A (final concentration 0.25 mg/mL) and purified using a Zymo DNA C&C kit according to the manufacturer’s instructions.
The recovered DNA was prepared for sequencing using a NEBNext Ultra 2 DNA sequencing preparation kit with UMI adapters
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
NextSeq 2000 |
| |
|
| Description |
Gel extraction of high molecular weight BSB-associated region in WT cells
|
| Data processing |
The resulting gel-extracted reads were preprocessed using cutadapt to remove identifiable adapter sequences (AGATCGGAAGAGCACACGTCTGAACTCCAGTCA in read 1, AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT in read 2),
followed by Trimmomatic to remove low quality read ends (arguments: TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:14)
The resulting reads were aligned to the E. coli genome using bowtie2
The resulting reads were aligned to the E. coli genome using bowtie2 and then coverage quantified using bedtools genomecov
Assembly: E coli K12 U00096.3
Supplementary files format and content: *log10abund.bedgraph: normalized log10 ratio of extracted to input read densities at each location
Supplementary files format and content: *rzscore.bedgraph: robust z-scored version of the log10 ratios
|
| |
|
| Submission date |
Aug 21, 2023 |
| Last update date |
Apr 01, 2024 |
| Contact name |
Lydia Freddolino |
| E-mail(s) |
lydsf@umich.edu
|
| Organization name |
University of Michigan
|
| Department |
Biological Chemistry
|
| Lab |
Freddolino Lab
|
| Street address |
1150 W. Medical Center Dr., MSRB 3 room 3315
|
| City |
Ann Arbor |
| State/province |
MI |
| ZIP/Postal code |
48109-0600 |
| Country |
USA |
| |
|
| Platform ID |
GPL30519 |
| Series (2) |
| GSE241317 |
Bacterial Stress Bodies – Ancestral Condensates Regulating RNA Turnover and Protein Translation I |
| GSE241322 |
Bacterial Stress Bodies – Ancestral Condensates Regulating RNA Turnover and Protein Translation |
|
| Relations |
| BioSample |
SAMN37098892 |
| SRA |
SRX21439461 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM7721011_WT_r2_DNA_gelread_quant_log10abund.bedgraph.gz |
5.5 Mb |
(ftp)(http) |
BEDGRAPH |
| GSM7721011_WT_r2_DNA_gelread_quant_rzscore.bedgraph.gz |
5.6 Mb |
(ftp)(http) |
BEDGRAPH |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
