|
|
GEO help: Mouse over screen elements for information. |
|
Status |
Public on May 01, 2024 |
Title |
RP107_340_IRP1_ko/ko_ZT12_Rep1_RPF |
Sample type |
SRA |
|
|
Source name |
IRP1_ko/ko_ZT12_Rep1_RPF
|
Organism |
Mus musculus |
Characteristics |
tissue: liver genotype: IRP1 Knockout time: ZT12
|
Extracted molecule |
other |
Extraction protocol |
For ribosome profiling, frozen liver tissues from individual mice were homogenized with 5-6 strokes using a Teflon homogenizer in 3 volumes of polysome buffer (150 mM NaCl, 20 mM Tris-HCl pH7.4, 5 mM MgCl2, 5 mM DTT, complete EDTA-free protease inhibitors (Roche) and 40 U/ml RNasin plus (Promega)) supplemented with 1% Triton X-100 and 0.5% Na deoxycholate. Liver lysates were incubated on ice for 10 min and cleared by centrifugation at 10000g, 4°C for 10 min. For each sample, 15 OD260 of liver lysate was digested with RNase I (Ambion) for 45 min at RT under gentle agitation and passed over size exclusion columns for ribosome purification prior to RNA extraction and library preparation. Libraries from ribosome-protected fragments (RPF) and total RNA were prepared as described in Janich et al., 2015 with few modifications. 1 µg of RPF and total RNA samples were depleted of ribosomal RNA using RiboCop rRNA depletion kit V1.3 (Lexogen). Subsequent steps were performed according to Illumina TruSeq Ribo-Profile protocol.
|
|
|
Library strategy |
OTHER |
Library source |
other |
Library selection |
other |
Instrument model |
Illumina HiSeq 2500 |
|
|
Data processing |
Read adapters (AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC) were trimmed using cutadapt (v 3.5) with the following options: --match-read-wildcards --overlap 8 --discard-untrimmed --minimum-length 30 and reads were quality filtered using fastx_toolkit (-Q33 -q 30 -p 90). Trimmed read sequences were filtered by their size using an in-house Python script with following inclusive ranges: [26,35] for footprints, [21,60] for total RNA. Reads were then mapped to rRNA and tRNA databases to remove contaminants using bowtie2 (-p 2 -L 15 -k 20 --no-unal -q). Only reads that did not map to the above databases were mapped to mouse genome v38.100 using STAR (version 2.70f). Assembly: mouse genome v38.100 Library strategy: Ribo-seq
|
|
|
Submission date |
Sep 13, 2023 |
Last update date |
May 01, 2024 |
Contact name |
Hima Priyanka Nadimpalli |
E-mail(s) |
himapriyanka.nadimpalli@unil.ch, david.gatfield@unil.ch
|
Organization name |
UNIL - CIG
|
Lab |
Gatfield
|
Street address |
Génopode Building, Room 500
|
City |
Lausanne |
ZIP/Postal code |
CH-1015 |
Country |
Switzerland |
|
|
Platform ID |
GPL17021 |
Series (1) |
GSE243134 |
Diurnal control of iron responsive element containing mRNAs through iron regulatory proteins IRP1 and IRP2 is mediated by feeding rhythms |
|
Relations |
BioSample |
SAMN37386060 |
SRA |
SRX21771761 |
Supplementary file |
Size |
Download |
File type/resource |
GSM7779735_RP107_340_1_counts.txt.gz |
97.0 Kb |
(ftp)(http) |
TXT |
SRA Run Selector |
Raw data are available in SRA |
|
|
|
|
|