NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM7781891 Query DataSets for GSM7781891
Status Public on Jun 27, 2024
Title hpGUS23_4
Sample type SRA
 
Source name leaf
Organism Nicotiana tabacum
Characteristics tissue: leaf
genotype: W38
Growth protocol tobacco plants were grown under long day condiitions and leaf material collected for sequencing
Extracted molecule total RNA
Extraction protocol RNA was extracted using trizol
sRNA library Prep
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection cDNA
Instrument model Illumina NovaSeq 6000
 
Description hpGUS[Δ23nt] rep 1
Data processing Reads were trimmed using cut adapt -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA --minimum-length=15
Trimmed reads were mapped to the tobacco genome, GUS gene and sense strand of the stem of asymmetric bulge hairpins
Reads were mapped using Bowtie 1.3.1 with options -v 0 -a --best --strata -l 18
awk commands were used to filter out reads mapping to GUS with only unique reads retained for downstream analysis
Assembly: GCA_002210045.1_Nitab4.5_genomic.fna
Supplementary files format and content: raw files are in fastq format
Supplementary files format and content: processed files are unique reads mapped to the GUS gene in a .bed format. Rows are 1 = mapping to GUS or asymmetric bulge sense strands; 2 = Start; 3= End; 4 = read name; 5 = quality; 6 = strand; 7 = sRNA size
 
Submission date Sep 14, 2023
Last update date Jun 27, 2024
Contact name Ian K Greaves
E-mail(s) ian.greaves@csiro.au
Phone 61 6246 4828
Organization name csiro
Street address clunies ross street
City Acton
State/province act
ZIP/Postal code 2601
Country Australia
 
Platform ID GPL29390
Series (2)
GSE243255 Asymmetric bulges within hairpin RNA transgenes influence small RNA size, secondary siRNA production and viral defence I
GSE243297 Asymmetric bulges within hairpin RNA transgenes influence small RNA size, secondary siRNA production and viral defence
Relations
BioSample SAMN37398995
SRA SRX21781390

Supplementary file Size Download File type/resource
GSM7781891_hpGUS23_4_GUS_unique.bed.gz 1.9 Mb (ftp)(http) BED
SRA Run SelectorHelp
Raw data are available in SRA

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap