|
| Status |
Public on Jun 27, 2024 |
| Title |
hpGUS242_11 |
| Sample type |
SRA |
| |
|
| Source name |
leaf
|
| Organism |
Nicotiana tabacum |
| Characteristics |
tissue: leaf
genotype: W38
|
| Growth protocol |
tobacco plants were grown under long day condiitions and leaf material collected for sequencing
|
| Extracted molecule |
total RNA |
| Extraction protocol |
RNA was extracted using trizol
sRNA library Prep
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina NovaSeq 6000 |
| |
|
| Description |
hpGUS[Δ24nt-2] rep 3
|
| Data processing |
Reads were trimmed using cut adapt -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA --minimum-length=15
Trimmed reads were mapped to the tobacco genome, GUS gene and sense strand of the stem of asymmetric bulge hairpins
Reads were mapped using Bowtie 1.3.1 with options -v 0 -a --best --strata -l 18
awk commands were used to filter out reads mapping to GUS with only unique reads retained for downstream analysis
Assembly: GCA_002210045.1_Nitab4.5_genomic.fna
Supplementary files format and content: raw files are in fastq format
Supplementary files format and content: processed files are unique reads mapped to the GUS gene in a .bed format. Rows are 1 = mapping to GUS or asymmetric bulge sense strands; 2 = Start; 3= End; 4 = read name; 5 = quality; 6 = strand; 7 = sRNA size
|
| |
|
| Submission date |
Sep 14, 2023 |
| Last update date |
Jun 27, 2024 |
| Contact name |
Ian K Greaves |
| E-mail(s) |
ian.greaves@csiro.au
|
| Phone |
61 6246 4828
|
| Organization name |
csiro
|
| Street address |
clunies ross street
|
| City |
Acton |
| State/province |
act |
| ZIP/Postal code |
2601 |
| Country |
Australia |
| |
|
| Platform ID |
GPL29390 |
| Series (2) |
| GSE243255 |
Asymmetric bulges within hairpin RNA transgenes influence small RNA size, secondary siRNA production and viral defence I |
| GSE243297 |
Asymmetric bulges within hairpin RNA transgenes influence small RNA size, secondary siRNA production and viral defence |
|
| Relations |
| BioSample |
SAMN37398987 |
| SRA |
SRX21781398 |
