|
Status |
Public on Apr 19, 2024 |
Title |
K104421/K109177_ROI_6_well_B05 |
Sample type |
SRA |
|
|
Source name |
Breast tissues from healthy woman
|
Organism |
Homo sapiens |
Characteristics |
tissue: Breast tissues from healthy donor donated 10 years apart disease state: healthy donor slide id: K104421/K109177 roi number: 006 segment type: Full ROI area: 18030.16 nuclei_counts: 284 roi x coordinate: 16663 roi y coordinate: 10194 rawreads: 10152872 alignedreads: 9496577 deduplicatedreads: 81625 trimmedreads: 9734912 stitchedreads: 9676088 sequencingsaturation: 99
|
Extracted molecule |
total RNA |
Extraction protocol |
Samples were incubated with DNA-oligo barcoded RNA-ISH probes which were conjugated with a UV-photocleavable linker following standard ISH protocols, along with fluorescently labeled antibodies for visualization of morphological structures. Regions of interest within the tissue were illuminated with UV light and oligo barcodes were physically aspirated from the tissue and collected into microtiter plates by the GeoMx® Digital Spatial Profiler (DSP) platform. For more information about DSP protocols please see Merritt et al. Nature Biotech 2020 (doi: 10.1038/s41598-020-63539-x) Each collection of oligo tags from one well (representing an ROI from the tissue section) was indexed with i7xi5 unique dual indexes using GeoMx SeqCode primers with 18 cycles of PCR. After PCR, indexed AOIs were pooled and purified in two rounds of AMPure XP PCR purification using 1.2x bead:sample ratio. Samples were pooled during library preparation and split across lanes. Individual FASTQ files were generated for each lane, forward & reverse primers. The Fastq files contain the same identifier as the sample name for aggregation.
|
|
|
Library strategy |
OTHER |
Library source |
transcriptomic |
Library selection |
other |
Instrument model |
Illumina NovaSeq 6000 |
|
|
Description |
Library name: DSP-1008870999731-D-B05
|
Data processing |
dcc-metadata = true save-interim-files = false quality-trim-score = 20 2color-trimming = True adapter1 = AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC adapter2 = AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT adapter-trim-match-length = 10 adapter-trim-max-mismatch = 3 barcode-max-mismatch = 1 stitching-max-mismatch = 2 dedup-hd = 1 threads = 4 Supplementary files format and content: dcc Library strategy: GeoMx Seq
|
|
|
Submission date |
Oct 04, 2023 |
Last update date |
Apr 19, 2024 |
Contact name |
Harikrishna Nakshatri |
Organization name |
Indiana University School of Medicine
|
Department |
General Surgery
|
Street address |
980 W. Walnut St. R3C218C
|
City |
Indianapolis |
State/province |
IN |
ZIP/Postal code |
46202 |
Country |
USA |
|
|
Platform ID |
GPL24676 |
Series (2) |
GSE244593 |
Single nuclei chromatin accessibility and transcriptomic map of breast tissues of women of diverse genetic ancestry [GeoMx] |
GSE244594 |
Single nuclei chromatin accessibility and transcriptomic map of breast tissues of women of diverse genetic ancestry |
|
Relations |
BioSample |
SAMN37672196 |
SRA |
SRX21985422 |