 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Mar 07, 2024 |
| Title |
input_WT, rep2 |
| Sample type |
SRA |
| |
|
| Source name |
whole seedlings
|
| Organisms |
Arabidopsis thaliana; Drosophila melanogaster |
| Characteristics |
tissue: whole seedlings
cell line: 7-day-old seedlings
genotype: wild type
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
H2B and H2Bub ChIP-Rx were conducted in parallel using the same two biological replicates of 7-day-old WT and elf7-3 seedlings grown under standard conditions. For each biological replicate, two immunoprecipitations (IP) were performed using an anti-H2Bub antibody (MM-0029-P, Medimabs) and one using an anti-H2B (ab1790, abcam). 100 µg of Arabidopsis chromatin mixed with 3 µg of Drosophila chromatin was used for each IP. DNA eluted from the two technical replicates of H2Bub IP was pooled before library preparation. Library preparation and sequencing were carried out by the CRG Genomics Core Facility (Barcelona, Spain). Flag-ELF7 and GFP-VIP3 ChIP-seq was performed using 7-day-old seedlings and an anti-Flag M2 antibody (F1804, Sigma). We used double in vitro crosslinking using 1.5 mM ethylene glycol bis (succinimidyl succinate) for 20 min and then with 1% formaldehyde for 10 min at room temperature. Library preparation and sequencing were carried out by the CRG Genomics Core Facility (Barcelona, Spain). ChIP-seq for RNAPII was done using the anti-NRPB1 antibody (active motif, Clone: 4H8) using similar growth conditions and protocol than for H2Bub profiling without Drosophila cells spike-in. Library preparation and sequencing were carried out by the Epigenomics platform at IPS2 (Paris, France).
Libraries were prepared using commercial kits as follows: GFP-VIP3, H2B and H2Bub with NEBNext® Ultra DNA Library Prep for Illumina® kit, PolII with NEBNext® Ultra II DNA Library Prep for Illumina® kit, and Flag-ELF7 with Ovation Ultralow System V2.
|
| |
|
| Library strategy |
ChIP-Seq |
| Library source |
genomic |
| Library selection |
ChIP |
| Instrument model |
Illumina HiSeq 2000 |
| |
|
| Data processing |
Raw reads were trimmed using cutadapt v4.4 with parameters -q 15,10 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA -m 20
Clean reads were aligned to the TAIR10 genome using bowtie2 v2.5.1 with default parameters
Duplicates were marked with sambamba v1.0. Alignments were filtered using samtools (v1.17) view with options -q 5 -F 4 -F 1024
BigWig files were obtained using bedtools (v2.31.0) genomecov and UCSC bedGraphToBigWig. Bigwigs were scaled to their normalization factors using wiggletools (v1.2.11) scale
For FLAG-ELF7, GFP-VIP3 and Pol II ChIPs, samples were scaled by sequencing depth (CPM). H2Bub samples were normalized by the amount of Drosophila reads in the IP and the input as in Nassrallah et al. 2018
Peaks were called using macs2 v2.2.7.1 with options --keep-duplicates all --nomodel --extsize 200 --broad --broad-cutoff 0.05 -gs 119144248
Assembly: TAIR10
Supplementary files format and content: Raw bigwigs
Supplementary files format and content: broadPeaks
|
| |
|
| Submission date |
Oct 06, 2023 |
| Last update date |
Mar 07, 2024 |
| Contact name |
Jaime Pérez |
| E-mail(s) |
jperezalemany96@gmail.com
|
| Phone |
629524057
|
| Organization name |
IBMCP
|
| Street address |
Calle del Ingeniero Fausto Elio, s/n
|
| City |
Valencia |
| ZIP/Postal code |
46011 |
| Country |
Spain |
| |
|
| Platform ID |
GPL33827 |
| Series (2) |
| GSE244846 |
The plant POLYMERASE-ASSOCIATED FACTOR1 complex links transcription and H2B monoubiquitination genome wide [ChIP-seq] |
| GSE244850 |
The plant POLYMERASE-ASSOCIATED FACTOR1 complex links transcription and H2B monoubiquitination genome wide |
|
| Relations |
| BioSample |
SAMN37711665 |
| SRA |
SRX22022095 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM7830732_input_WT_rep2.bw |
148.3 Mb |
(ftp)(http) |
BW |
SRA Run Selector |
| Raw data are available in SRA |
|
|
|
|
 |
