 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Feb 22, 2024 |
| Title |
cb_smallRNA_TC_WT_33h |
| Sample type |
SRA |
| |
|
| Source name |
AF16
|
| Organism |
Caenorhabditis briggsae |
| Characteristics |
strain: AF16
genotype: WT
time (h): 33
treatment: none
|
| Treatment protocol |
no treatment
|
| Growth protocol |
Synchronized L1's of WT C. briggsae were plated on 10 cm plates (2000 worms/plate) and kept at 25°C for the time-course. Every hour samples were collected from 18h to 33h
|
| Extracted molecule |
total RNA |
| Extraction protocol |
We harvested worms from 18h to 33h in hourly interval. Worms were collected from paltes and washed 3 times and resuspended in Tri Reagent (MRC, TR118) and RNA was extracted using conventional phenol extraction, as described previously (Hendriks et al., 2014). Total RNA was DNAse treated
Sequencing libraries were generated using Illumina TruSeq Small RNA Library Prep Kit according to the manufacturer’s instructions. Subsequently, library was sequenced on Illumina HiSeq2500, as 50 cycles single-end reads.
|
| |
|
| Library strategy |
ncRNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Data processing |
The small RNA-seq fastq files were adapter trimmed (TGGAATTCTCGGGTGCCAAGG) at the 3' end using the function preprocessReads() from the R packege QuasR (version 1.26) and mapped to the C.briggsae genome (WS225) with the R package QuasR (version 1.26) using the alignment algorithm Bowtie. The command used to perform the alignments was "proj <- qAlign("samples.txt","BSgenome.Celegans.UCSC.ce10",maxHits=100)". For miRNA quantification, gene annotation from MirgeneDB2 was used. We extended the genomic coordinates of the 5' end of each miRNA by 3bp on both sides and counted all the reads that started within those regions using the following command: "qCount(proj,matureMirsExt,orientation="same"). To normalize for sequencing depth, each sample was divided by the total number of reads and multiplied by the average library size. Finally the count table was log2 transformed after the addition of a pseudocount of 8 in order to minimize large changes in expression caused by low count numbers.
Assembly: WS225
Supplementary files format and content: tab-delimited text file with raw counts for each sample
Supplementary files format and content: tab-delimited text file with normalized counts for each sample
|
| |
|
| Submission date |
Oct 20, 2023 |
| Last update date |
Feb 22, 2024 |
| Contact name |
Dimos Gaidatzis |
| E-mail(s) |
d.gaidatzis@fmi.ch
|
| Organization name |
Friedrich Miescher Institute for Biomedical Research
|
| Department |
Computational Biology
|
| Street address |
Maulbeerstrasse 66
|
| City |
Basel |
| ZIP/Postal code |
4058 |
| Country |
Switzerland |
| |
|
| Platform ID |
GPL21214 |
| Series (2) |
| GSE245894 |
Dynamic regulation of miRNA accumulation during C. elegans larval development [smallRNA-Seq 1] |
| GSE245904 |
Dynamic regulation of miRNA accumulation during C. elegans larval development |
|
| Relations |
| BioSample |
SAMN37906268 |
| SRA |
SRX22156655 |
| Supplementary data files not provided |
SRA Run Selector |
| Raw data are available in SRA |
|
|
|
|
 |
