|
Status |
Public on Feb 22, 2024 |
Title |
ce_smallRNA_ebax_TC_N2_21h |
Sample type |
SRA |
|
|
Source name |
N2
|
Organism |
Caenorhabditis elegans |
Characteristics |
strain: N2 genotype: WT time (h): 21 treatment: none
|
Treatment protocol |
no treatment
|
Growth protocol |
Synchronized L1's of N2 and HW3527 (ebax-1(tm2321) IV ) were plated on 10 cm plates (2000 worms/plate) and kept at 25°C for the time-course. Every hour samples were collected from 18h to 31h
|
Extracted molecule |
total RNA |
Extraction protocol |
We harvested worms from 18h to 31h in hourly interval. Worms were collected from plates and washed 3 times and resuspended in Tri Reagent (MRC, TR118) and RNA was extracted using Direct-zol™ RNA MicroPrep kit (Zymo Research; R2062) as per manufacturere's instructions. Total RNA was treated with DNAse on column Sequencing libraries were generated using CleanTag Small RNA Library Preparation Kit according to the manufacturer’s instructions. The library pool was size selected on a gel (140-160 bp) to enrich for the small RNA fraction. Subsequently, library was sequenced on NextSeq500, as 76 cycles single-end reads.
|
|
|
Library strategy |
ncRNA-Seq |
Library source |
transcriptomic |
Library selection |
size fractionation |
Instrument model |
Illumina NextSeq 500 |
|
|
Data processing |
The small RNA-seq fastq files were adapter trimmed (TGGAATTCTCGGGTGCCAAGG) at the 3' end using the function preprocessReads() from the R packege QuasR (version 1.26) and mapped to the C.elegans genome (ce10) with the R package QuasR (version 1.26) using the alignment algorithm Bowtie. The command used to perform the alignments was "proj <- qAlign("samples.txt","BSgenome.Celegans.UCSC.ce10",maxHits=100)". For miRNA quantification, gene annotation from miRBase v22 was used and lifted over to ce10. We extended the genomic coordinates of the 5' end of each miRNA by 3bp on both sides and counted all the reads that started within those regions using the following command: "qCount(proj,matureMirsExt,orientation="same"). To normalize for sequencing depth, each sample was divided by the total number of reads and multiplied by the average library size. Finally the count table was log2 transformed after the addition of a pseudocount of 8 in order to minimize large changes in expression caused by low count numbers. Assembly: ce10 Supplementary files format and content: tab-delimited text file with raw counts for each sample Supplementary files format and content: tab-delimited text file with normalized counts for each sample
|
|
|
Submission date |
Oct 20, 2023 |
Last update date |
Feb 22, 2024 |
Contact name |
Dimos Gaidatzis |
E-mail(s) |
d.gaidatzis@fmi.ch
|
Organization name |
Friedrich Miescher Institute for Biomedical Research
|
Department |
Computational Biology
|
Street address |
Maulbeerstrasse 66
|
City |
Basel |
ZIP/Postal code |
4058 |
Country |
Switzerland |
|
|
Platform ID |
GPL19757 |
Series (2) |
GSE245895 |
Dynamic regulation of miRNA accumulation during C. elegans larval development [smallRNA-Seq 2] |
GSE245904 |
Dynamic regulation of miRNA accumulation during C. elegans larval development |
|
Relations |
BioSample |
SAMN37905730 |
SRA |
SRX22156279 |