|
| Status |
Public on Feb 07, 2024 |
| Title |
zebrafish_shield_20µM_lnamir430_50mM_s4u_r3 |
| Sample type |
SRA |
| |
|
| Source name |
Embryos at shield stage
|
| Organism |
Danio rerio |
| Characteristics |
tissue: Embryos
Stage: shield stage
genotype: Offspring of [AB-TU]x[TL-TLF]
treatment: 1000pL of 20µM lna against miR-430 seed and 50mM s4UTP injection
|
| Treatment protocol |
Embryos were injected with ~1000pL of 50mM s4-UTP plus 20µM of either locked nucleic acid against miR-430 seed or a mismatch oligo.
|
| Growth protocol |
Zebrafish embryos were collected from natural breeding, with random mating parents, embryos were kept at 28.5 C in 0.5x Embryo Media.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Trizol™
QuantSeq 3′ mRNA-Seq Library Prep Kit for Illumina UDI Bundle (FWD, Lexogen GmbH, cat. no. 144.96)
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
NextSeq 2000 |
| |
|
| Data processing |
Slamdunk 0.4.3.
Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
Reads that contain at least 2 T>C conversions were deemed labeled.
Assembly: danRer11
Supplementary files format and content: Comma-separated values, <.csv>; Total raw read and labeled read counts for all experiments and samples, including spike-ins. Rows represent different 3'UTR isoforms (for coding genes) or full-length transcript (non-coding genes). Columns represent: Ensembl gene IDs by itself (non-coding transcripts) + 3'UTR isoforms (coding transcripts), or ERCC IDs (spike ins); Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;
|
| |
|
| Submission date |
Nov 15, 2023 |
| Last update date |
Feb 07, 2024 |
| Contact name |
Ariel Alejandro Bazzini |
| Organization name |
Stowers Institute for Medical Research
|
| Lab |
Bazzini Lab
|
| Street address |
1000 E 50th St
|
| City |
Kansas City |
| State/province |
Missouri |
| ZIP/Postal code |
64110 |
| Country |
USA |
| |
|
| Platform ID |
GPL30614 |
| Series (2) |
| GSE247930 |
Slam-seq reveals that miR-430 regulates zygotic mRNA during zebrafish embryogenesis [lna_data] |
| GSE247935 |
Slam-seq reveals that miR-430 regulates zygotic mRNA during zebrafish embryogenesis |
|
| Relations |
| BioSample |
SAMN38271975 |
| SRA |
SRX22541143 |
