NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM7903259 Query DataSets for GSM7903259
Status Public on Feb 07, 2024
Title zebrafish_3hour_wt_75mM_s4u_r2
Sample type SRA
 
Source name Embryos at 3 hours post-fertilization
Organism Danio rerio
Characteristics tissue: Embryos
Stage: 3 hours post-fertilization
genotype: Offspring of [AB-TU]x[TL-TLF]
Treatment protocol Embryos were injected with ~1000pL of 75mM s4-UTP.
Growth protocol Zebrafish embryos were collected from natural breeding, with random mating parents, embryos were kept at 28.5 C in 0.5x Embryo Media.
Extracted molecule total RNA
Extraction protocol Trizolâ„¢
QuantSeq 3′ mRNA-Seq Library Prep Kit for Illumina UDI Bundle (FWD, Lexogen GmbH, cat. no. 144.96)
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection cDNA
Instrument model NextSeq 2000
 
Data processing Slamdunk 0.4.3.
Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
Reads that contain at least 2 T>C conversions were deemed labeled.
Assembly: danRer11
Supplementary files format and content: Comma-separated values, <.csv>; Total raw read and labeled read counts for all experiments and samples, including spike-ins. Rows represent different 3'UTR isoforms (for coding genes) or full-length transcript (non-coding genes). Columns represent: Ensembl gene IDs by itself (non-coding transcripts) + 3'UTR isoforms (coding transcripts), or ERCC IDs (spike ins); Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;
 
Submission date Nov 15, 2023
Last update date Feb 07, 2024
Contact name Ariel Alejandro Bazzini
Organization name Stowers Institute for Medical Research
Lab Bazzini Lab
Street address 1000 E 50th St
City Kansas City
State/province Missouri
ZIP/Postal code 64110
Country USA
 
Platform ID GPL30614
Series (2)
GSE247933 Slam-seq reveals that miR-430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse_data]
GSE247935 Slam-seq reveals that miR-430 regulates zygotic mRNA during zebrafish embryogenesis
Relations
BioSample SAMN38271999
SRA SRX22541153

Supplementary file Size Download File type/resource
GSM7903259_reads_s3h_2_subset.csv.gz 748.9 Kb (ftp)(http) CSV
SRA Run SelectorHelp
Raw data are available in SRA

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap