|
Status |
Public on Feb 07, 2024 |
Title |
zebrafish_4hour_wt_75mM_s4u_r3 |
Sample type |
SRA |
|
|
Source name |
Embryos at 4 hours post-fertilization
|
Organism |
Danio rerio |
Characteristics |
tissue: Embryos Stage: 4 hours post-fertilization genotype: Offspring of [AB-TU]x[TL-TLF]
|
Treatment protocol |
Embryos were injected with ~1000pL of 75mM s4-UTP.
|
Growth protocol |
Zebrafish embryos were collected from natural breeding, with random mating parents, embryos were kept at 28.5 C in 0.5x Embryo Media.
|
Extracted molecule |
total RNA |
Extraction protocol |
Trizol™ QuantSeq 3′ mRNA-Seq Library Prep Kit for Illumina UDI Bundle (FWD, Lexogen GmbH, cat. no. 144.96)
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
cDNA |
Instrument model |
NextSeq 2000 |
|
|
Data processing |
Slamdunk 0.4.3. Adapter sequence: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Reads that contain at least 2 T>C conversions were deemed labeled. Assembly: danRer11 Supplementary files format and content: Comma-separated values, <.csv>; Total raw read and labeled read counts for all experiments and samples, including spike-ins. Rows represent different 3'UTR isoforms (for coding genes) or full-length transcript (non-coding genes). Columns represent: Ensembl gene IDs by itself (non-coding transcripts) + 3'UTR isoforms (coding transcripts), or ERCC IDs (spike ins); Chromosome name; Genomic start of feature; Genomic end of feature; DNA strand of feature; Number of Ts within feature;
|
|
|
Submission date |
Nov 15, 2023 |
Last update date |
Feb 07, 2024 |
Contact name |
Ariel Alejandro Bazzini |
Organization name |
Stowers Institute for Medical Research
|
Lab |
Bazzini Lab
|
Street address |
1000 E 50th St
|
City |
Kansas City |
State/province |
Missouri |
ZIP/Postal code |
64110 |
Country |
USA |
|
|
Platform ID |
GPL30614 |
Series (2) |
GSE247933 |
Slam-seq reveals that miR-430 regulates zygotic mRNA during zebrafish embryogenesis [timecourse_data] |
GSE247935 |
Slam-seq reveals that miR-430 regulates zygotic mRNA during zebrafish embryogenesis |
|
Relations |
BioSample |
SAMN38271995 |
SRA |
SRX22541157 |