|
| Status |
Public on Feb 26, 2012 |
| Title |
CRE Single 100uM Rep1 mRNA |
| Sample type |
SRA |
| |
|
| Source name |
HEK293 cells
|
| Organism |
Homo sapiens |
| Characteristics |
treatment: 100 uM forskolin (5 hours)
cell line: HEK293T/17
sample type: embyonic kidney cell line
reporter: CRE single-hit
|
| Growth protocol |
HEK293T/17 cells (ATCC CRL-11268) were cultured in DMEM (Mediatech) supplemented with 10% FBS and L-glutamine/penicillin/streptomycin.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total RNA was isolated from cell lysates using RNeasy kits (Qiagen). mRNA was extracted from total RNA using MicroPoly(A)Purist⢠kits (Ambion) and treated with DNase I using the Turbo DNA-free⢠kit (Ambion). First-strand cDNA was synthesized from 400-700 ng mRNA using High Capacity RNA-to-cDNA kits (Applied Biosystems). Tag-Seq sequencing libraries were generated directly from 12% of a cDNA reaction or 50 ng plasmid DNA by 26 cycle PCR using Pfu Ultra HS DNA polymerase 2x master mix (Agilent) and primers AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT and CAAGCAGAAGACGGCATACGAGATXXXXXXXXGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCGAGGTGCCTAAAGG (where XXXXXXXX is a library-specific index sequence). The resultant PCR products were size-selected using 2% agarose E-Gel EX (Invitrogen).
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina HiSeq 2000 |
| |
|
| Description |
Single-hit scanning mutagenesis of CRE, reporter mRNA
|
| Data processing |
To infer the tag copy numbers in each Tag-Seq library, all sequence reads were examined, regardless of their quality scores. If the first ten nucleotides of a read perfectly matched one of the 13,000 or 27,000 designed tags and the remaining nucleotides matched the expected upstream MPRA construct sequence, this was counted as one occurrence of that tag. All reads that did not meet this criterion were discarded.
|
| |
|
| Submission date |
Sep 08, 2011 |
| Last update date |
May 15, 2019 |
| Contact name |
Tarjei S Mikkelsen |
| Organization name |
Broad Institute
|
| Street address |
7 Cambridge Center
|
| City |
Cambridge |
| State/province |
MA |
| ZIP/Postal code |
02142 |
| Country |
USA |
| |
|
| Platform ID |
GPL11154 |
| Series (1) |
| GSE31982 |
Systematic dissection and optimization of inducible enhancers in human cells using a massively parallel reporter assay |
|
| Relations |
| SRA |
SRX096751 |
| BioSample |
SAMN00716619 |
